ubiA:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
| Standard Name |
ubiA |
|---|---|
| Gene Synonym(s) | |
| Product Desc. |
4OHBENZOATE- 4-Hydroxybenzoate polyprenyltransferase[3] |
| Product Synonyms(s) |
p-hydroxybenzoate octaprenyltransferase[1], B4040[2][1], Cyr[2][1], UbiA[2][1], 4-HB polyprenyltransferase[2][1] , cyr, ECK4032, JW4000, sdgG?, b4040 |
| Function from GO |
<GO_nr /> |
| Knock-Out Phenotype | |
| Regulation/Expression | |
| Regulation/Activity | |
| Quick Links |
|
| edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
ubiA |
|---|---|
| Mnemonic |
Ubiquinone |
| Synonyms | |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
91.62 minutes |
MG1655: 4251039..4251911 |
||
|
NC_012967: 4231948..4232820 |
||||
|
NC_012759: 4189884..4190756 |
||||
|
W3110 |
|
W3110: 4256606..4257478 |
||
|
DH10B: 4350735..4351607 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ubiA::Tn10dCam |
Insertion |
Mutagenesis rate |
Decrease in the rate of Stress Induced Mutagenesis (SIM). |
PMID:23224554 |
Parent Strain: SMR4562 Experimental Strain: SMR12311 |
The mutation conferred a decrease in strong reduction in SIM with mutant frequency being reduced by 90 percent of the wild type. See table S3 for full experimental results. | |
|
ubiA::Tn10dCam |
Insertion |
SDS-EDTA Sensitivity |
Increase in SDS-EDTA sensitivity |
PMID:23224554 |
Parent Strain: SMR4562 Experimental Strain: SMR12311 |
The mutation conferred an an increase in SDS-EDTA sensitivity relative to the wild type. See table S7 for a summary of results. | |
|
ubiA::Tn10dCam |
Insertion |
Increased sensitivity toward UV radiation |
PMID:23224554 |
Parent Strain: SMR4562 Experimental Strain: SMR12311 |
The mutation conferred an an increase in UV sensitivity relative to the wild type. See table S7 for a review of experimental results. | ||
|
SMR4562 yiaG-yfp FRT ubiA::Tn10dCam |
Insertion |
Sigma S activity |
Decrease in SigmaS activity |
PMID:23224554 |
Parental Strain: SMR10582 Experimental Strain: SMR14447 |
See table S8 for full experimental results. | |
|
CAG45114 ubiA::Tn10dCam |
Insertion |
SigmaE activity |
Decrease in sigmaE activity |
PMID:23224554 |
Parental Strain: CAG45114 Experimental Strain: SMR15321 |
See table S11 for full experimental data. | |
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW4000 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCGAGTGGAGTCTGACGCAGAA Primer 2:CCGAAATGCCAGTAACTCATTGC | |
|
Kohara Phage |
PMID:3038334 | ||
|
Kohara Phage |
PMID:3038334 | ||
|
Linked marker |
est. P1 cotransduction: 70% [5] | ||
|
Linked marker |
est. P1 cotransduction: 7% [5] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG11370 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG11370 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120001338 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EchoBASE:EB1344 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0013229 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
| Standard name |
UbiA |
|
|---|---|---|
| Synonyms |
p-hydroxybenzoate octaprenyltransferase[1], B4040[2][1], Cyr[2][1], UbiA[2][1], 4-HB polyprenyltransferase[2][1] , cyr, ECK4032, JW4000, sdgG?, b4040 |
|
| Product description |
4OHBENZOATE- 4-Hydroxybenzoate polyprenyltransferase[3] |
4-hydroxybenzoate octaprenyltransferase[6] |
| EC number (for enzymes) |
| |
| edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
| Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
|---|---|---|---|---|---|---|---|---|
|
GO:0016021 |
integral to membrane |
ISS: Inferred from Sequence or Structural Similarity |
C |
Seeded from Riley et al 2006 [1]. nnSeven transmembrane helices predicted by TMHMM Server, v. 2 (PMID:11152613). |
Missing: with/from, reference | |||
|
GO:0000287 |
magnesium ion binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0460 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0005886 |
plasma membrane |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_01635 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0008412 |
4-hydroxybenzoate octaprenyltransferase activity |
PMID:8155731 |
IDA: Inferred from Direct Assay |
F |
complete | |||
|
GO:0005886 |
plasma membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0997 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0005886 |
plasma membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-1003 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006744 |
ubiquinone biosynthetic process |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_01635 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006744 |
ubiquinone biosynthetic process |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0831 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0008412 |
4-hydroxybenzoate octaprenyltransferase activity |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_01635 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0016020 |
membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0472 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0016021 |
integral to membrane |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000537 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0016021 |
integral to membrane |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR006370 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0016021 |
integral to membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0812 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0016021 |
integral to membrane |
GO_REF:0000023 |
IEA: Inferred from Electronic Annotation |
SP_SL:SL-9909 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
| edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
| Partner Type | Partner | Notes | References | Evidence |
|---|---|---|---|---|
| edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
| Compartment | Description | Evidence | Reference/Source | Notes |
|---|---|---|---|---|
|
plasma membrane |
C-terminus localized to the periplasm with 7 predicted transmembrane domains |
Daley et al. (2005) [7] |
||
|
plasma membrane |
From EcoCyc[6] |
| ||
| edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
| Name | |
|---|---|
| Sequence |
MEWSLTQNKL LAFHRLMRTD KPIGALLLLW PTLWALWVAT PGVPQLWILA VFVAGVWLMR AAGCVVNDYA DRKFDGHVKR TANRPLPSGA VTEKEARALF VVLVLISFLL VLTLNTMTIL LSIAALALAW VYPFMKRYTH LPQVVLGAAF GWSIPMAFAA VSESVPLSCW LMFLANILWA VAYDTQYAMV DRDDDVKIGI KSTAILFGQY DKLIIGILQI GVLALMAIIG ELNGLGWGYY WSILVAGALF VYQQKLIANR EREACFKAFM NNNYVGLVLF LGLAMSYWHF |
| Length |
290 |
| Mol. Wt |
32.512 kDa |
| pI |
9.3 (calculated) |
| Extinction coefficient |
87,890 - 88,265 (calc based on 11 Y, 13 W, and 3 C residues) |
| edit table |
Domains/Motifs/Modification Sites
|
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/>
|
|
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
| Resource type | Source | Notes/Reference |
|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
ASAP:ABE-0013229 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EcoCyc:EG11370 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG11370 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
RegulonDB:ECK120001338 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB1344 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
| Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
|---|---|---|---|---|---|---|---|
|
Protein |
E. coli K-12 MG1655 |
1121 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
276 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
645 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
| edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
|
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
 Figure courtesy of RegulonDB |
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:4251019..4251059
source=MG1655
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
| Allele Name | Mutation | Phenotype | Reference |
|---|---|---|---|
| edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
| Type | Reference | Notes |
|---|---|---|
|
microarray |
NCBI GEO profiles for ubiA | |
|
microarray |
Summary of data for ubiA from multiple microarray studies | |
| edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
| Resource Name | Resource Type | Description | Source | Notes |
|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions Related to ubiA Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG11370 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB1344 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG11370 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120001338 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0013229 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
| Organism | Homologs (Statistics) | Comments |
|---|---|---|
|
Anopheles gambiae |
|
From Inparanoid:20070104 |
|
Apis mellifera |
|
From Inparanoid:20070104 |
|
Arabidopsis thaliana |
|
From Inparanoid:20070104 |
|
Bos taurus |
|
From Inparanoid:20070104 |
|
Caenorhabditis briggsae |
|
From Inparanoid:20070104 |
|
Caenorhabditis elegans |
|
From Inparanoid:20070104 |
|
Canis familiaris |
|
From Inparanoid:20070104 |
|
Ciona intestinalis |
|
From Inparanoid:20070104 |
|
Dictyostelium discoideum |
|
From Inparanoid:20070104 |
|
Drosophila melanogaster |
|
From Inparanoid:20070104 |
|
Drosophila pseudoobscura |
|
From Inparanoid:20070104 |
|
Gallus gallus |
|
From Inparanoid:20070104 |
|
Homo sapiens |
|
From Inparanoid:20070104 |
|
Macaca mulatta |
|
From Inparanoid:20070104 |
|
Mus musculus |
|
From Inparanoid:20070104 |
|
Oryza gramene |
|
From Inparanoid:20070104 |
|
Pan troglodytes |
|
From Inparanoid:20070104 |
|
Rattus norvegicus |
|
From Inparanoid:20070104 |
|
Saccharomyces cerevisiae |
|
From Inparanoid:20070104 |
|
Schizosaccharomyces pombe |
|
From Inparanoid:20070104 |
|
Takifugu rubripes |
|
From Inparanoid:20070104 |
|
Tetraodon nigroviridis |
|
From Inparanoid:20070104 |
|
Xenopus tropicalis |
|
From Inparanoid:20070104 |
|
Shigella flexneri |
UBIA |
From SHIGELLACYC |
|
E. coli O157 |
UBIA |
From ECOO157CYC |
| edit table |
Do-It-Yourself Web Tools
<protect></protect>
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG11370 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG11370 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120001338 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB1344 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0013229 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 4.0 4.1 CGSC: The Coli Genetics Stock Center
- ↑ 5.0 5.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ 6.0 6.1 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ Daley, DO et al. (2005) Global topology analysis of the Escherichia coli inner membrane proteome. Science 308 1321-3 PubMed
Categories
- TMHMM Prediction
- Genes with homologs in Anopheles gambiae
- Genes with homologs in Apis mellifera
- Genes with homologs in Arabidopsis thaliana
- Genes with homologs in Bos taurus
- Genes with homologs in Caenorhabditis briggsae
- Genes with homologs in Caenorhabditis elegans
- Genes with homologs in Canis familiaris
- Genes with homologs in Ciona intestinalis
- Genes with homologs in Dictyostelium discoideum
- Genes with homologs in Drosophila melanogaster
- Genes with homologs in Drosophila pseudoobscura
- Genes with homologs in Gallus gallus
- Genes with homologs in Homo sapiens
- Genes with homologs in Macaca mulatta
- Genes with homologs in Mus musculus
- Genes with homologs in Oryza gramene
- Genes with homologs in Pan troglodytes
- Genes with homologs in Rattus norvegicus
- Genes with homologs in Saccharomyces cerevisiae
- Genes with homologs in Schizosaccharomyces pombe
- Genes with homologs in Takifugu rubripes
- Genes with homologs in Tetraodon nigroviridis
- Genes with homologs in Xenopus tropicalis
- Genes with homologs in Shigella flexneri
- Genes with homologs in E. coli O157
