{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

On One Page

Quickview |

Gene |

Product(s) |

Expression|

Evolution |

References |

Quickview

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Standard Name	tsx
Gene Synonym(s)	ECK0405, b0411, JW0401, T6rec, nupA^[1], nupA
Product Desc.	nucleoside channel; receptor of phage T6 and colicin K^[2]^[3] Outer membrane channel for nucleosides; receptor for phage T6 and colicin K^[4]
Product Synonyms(s)	nucleoside channel, receptor of phage T6 and colicin K^[1], B0411^[2]^[1], NupA^[2]^[1], Tsx^[2]^[1] , ECK0405, JW0401, nupA, T6rec, b0411
Function from GO	<GO_nr />
Knock-Out Phenotype
Regulation/Expression	transcription unit(s): tsx^[2]
Regulation/Activity
Quick Links
edit table

</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>

Notes

[back to top]

First 22 aa are predicted to be a type I signal peptide. The antibiotic albicidin enters via the Tsx channel.^[4]

Gene

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css> <protect>

Nomenclature

[back to top]

See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name	tsx
Mnemonic	T-six
Synonyms	ECK0405, b0411, JW0401, T6rec, nupA^[1], nupA
edit table

</protect>

Notes

Location(s) and DNA Sequence

[back to top]

<protect> See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain	Map location	Genome coordinates	Genome browsers	Sequence links
MG1655	9.28 minutes	MG1655: 431237..430353 <gbrowseImage> name=NC_000913:430353..431237 source=MG1655 preset=GeneLocation </gbrowseImage>	EcoCyc GBrowse(MG1655)	FASTA Dump EcoCyc Sequence Dump
REL606		NC_012967: 400435..399662 <gbrowseImage> name=NC_012967:399662..400435 source=REL606 preset=GeneLocation </gbrowseImage>	GBrowse (REL606)	FASTA Dump
BW2952		NC_012759: 333112..333996 <gbrowseImage> name=NC_012759:333112..333996 source=BW2952 preset=GeneLocation </gbrowseImage>	GBrowse (BW2952)	FASTA Dump
W3110		W3110: 431237..430353 <gbrowseImage> name=NC_007779:430353..431237 source=W3110 preset=GeneLocation </gbrowseImage>	GBrowse(W3110)	FASTA Dump
DH10B		DH10B: 370568..369684 <gbrowseImage> name=NC_010473:369684..370568 source=DH10B preset=GeneLocation </gbrowseImage>	GBrowse(DH10B)	FASTA Dump
edit table

</protect>

Notes

Sequence Features

[back to top]

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type	Strain	Genomic Location	Evidence	Reference	Notes
edit table

Notes

Alleles and Phenotypes

[back to top]

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele	Nt change(s)	AA change(s)	Phenotype: Type	Phenotype: Description	Reference	Availability	Comments
tsx(del) (Keio:JW0401)	deletion	deletion			PMID:16738554	Shigen CGSC8574^[5]
tsxN276Y		N276Y		(in phage resistant mutant)			Strain variation; seeded from UniProt:P0A927
tsx-247::Tn10	Insertion at 430,667 bp in MG1655 (NC_000913)				adapted from Nichols et al.^[6]	CAG12148 = CGSC7337^[5]	Synonyms:
tsx-33						CGSC:4496
tsx-29						CGSC:4846
tsx-67						CGSC:4930
tsx-1						CGSC:5240
tsx-70						CGSC:5297
tsx-358						CGSC:5309
tsx-81						CGSC:5575
tsx-76						CGSC:5602
tsx-79						CGSC:5608
tsx-84						CGSC:5663
tsx-95						CGSC:5684
tsx-7						CGSC:5796
tsx-63						CGSC:5830
tsx-78						CGSC:5945
tsx-96						CGSC:6184
tsx-71						CGSC:6370
tsx-64						CGSC:6458
tsx-273						CGSC:6598
tsx-97						CGSC:6623
tsx-0						CGSC:6729
tsx-68						CGSC:7094
tsx-463						CGSC:7525
tsx-352						CGSC:7563
tsx-83						CGSC:7609
tsx-80						CGSC:7845
tsx-82						CGSC:7912
tsx-65						CGSC:8002
tsx-354						CGSC:8220
tsx-356						CGSC:8224
tsx-357						CGSC:8227
tsx-3						CGSC:8257
tsx-61						CGSC:8309
tsx-59						CGSC:8355
tsx-6						CGSC:8384
tsx-274						CGSC:8505
tsx-87						CGSC:8763
tsx-23						CGSC:8896
tsx-25						CGSC:8897
tsx-464						CGSC:9000
tsx-36						CGSC:9084
tsx-57						CGSC:9107
tsx-5						CGSC:9357
tsx-353						CGSC:9453
tsx-462::Tn10						CGSC:9490
tsx-93						CGSC:9803
tsx-466						CGSC:9983
tsx-69						CGSC:10430
tsx-465(Am)						CGSC:10863	amber (UAG) mutation
tsx-72						CGSC:11129
tsx-21						CGSC:11149
tsx-2						CGSC:11151
tsx-85						CGSC:11842
tsx-460						CGSC:12214
tsx-18						CGSC:13122
tsx-17						CGSC:13168
tsx-27						CGSC:13213
tsx-4						CGSC:13243
tsx-58						CGSC:13378
tsx-62						CGSC:13948
tsx-73						CGSC:14208
tsx-459						CGSC:14332
tsx-19						CGSC:15762
tsx-37						CGSC:16094
tsx-77						CGSC:17075
tsx-247::Tn10						CGSC:39365
tsx-3100::Tn10kan						CGSC:39368
tsx-35						CGSC:43389
tsx-74						CGSC:72463
tsx-75						CGSC:72484
tsx-773(del)::kan					PMID:16738554	CGSC:103248
tsx mutation in P1807			Sensitivity to	Reduced sensitivity toward albicidin.	PMID:2191080		See Figure 1 B for full experimental results.
tsx mutation in strain P1807			Metabolic uptake	Mutation to the tsx region caused a reduced uptake of nucleoside.	PMID:2191080		See figure 2 for full experimental results.
tsx mutation in strain GP4			Metabolic uptake	Mutation to the tsx region caused a reduced uptake of ablicidin.	PMID:2191080		These results support the theory that ablicidin resistance is due to reduced uptake of the antibiotic. See figure 3b for experimental results.
tsx^- in P407			Resistant to	Resistance to Bacteriophage T6	PMID:786267		Mutation to the tsx gene confers resistance to phage T6, possibly by reducing the production of a protein thought to be involved in phage binding, tsx-protein.
tsx^--con^- in P1731			Resistant to	Resistance to Bacteriophage T6	PMID:786267		A double mutation to the tsx and con gene confers resistance to phage T6, possibly by reducing the production of a protein thought to be involved in phage binding, tsx-protein.
tsx^- in P407			Resistant to	Resistance to Colicin K	PMID:786267		Mutation to the tsx gene confers resistance to Colicin K possibly by reducing the production of a specific protein, tsx-protein.
tsx^--con^- in P1731			Resistant to	Resistance to Colicin K	PMID:786267		A double mutation to the tsx and con gene confers resistance to Colicin K, possibly by reducing the production of a protein thought to be involved in phage binding, tsx-protein.
tsx-2 in strain KG16			Resistant to	Resistance to strain Phage T6	PMID:6808961		tsx-2 class of mutants were resistant to bacteriophage T6. This was also seen in strain KG19.
tsx-2 in strain KG16			Resistant to	Resistance to Colicin K	PMID:6808961		tsx-2 class of mutants became more resistant to Colicin K. This was also seen in strain KG19.
tsx-1 in strain GG24			Resistant to	Resistance to strain Phage T6	PMID:6808961		tsx-1 class of mutants developed an increased resistance toward bacteriophage T6. This was also seen in strain GG26.
tsx-1 in strain GG24d			Resistant to	Resistance to Colicin K	PMID:6808961		tsx-2 class of mutants became more resistant to Colicin K. This was also seen in strain GG24.
tsx-2 in strain KG16			Growth Phenotype	Muciod growth	PMID:6808961		It was found that the tsx-2 class of mutants produced a Muciod type growth configuration. This included strain KG19.
tsx-2 in strain KG16			Sensitivity to	Increased sensitivity to Neomycin.	PMID:6808961		It was found that the tsx-2 class of mutants became increasingly sensitive to aminoglycosides Neomycin and Kanamycin. This included strain KG19.
tsx-2 in strain KG16			Sensitivity to	Increased sensitivity to Kanamycin.	PMID:6808961		It was found that the tsx-2 class of mutants became increasingly sensitive to aminoglycosides Neomycin and Kanamycin. This included strain KG19.
tsx-2			Sensitivity to	The tsx-2 mutation caused increased sensitivity toward the antibiotic nalidixic acid.	PMID:6808961	Experimental Strain: KG16
edit table

Notes

Genetic Interactions

[back to top]

Interactor	Interaction	Allele	Score(s)	Reference(s)	Accessions	Notes
edit table

</protect>

Notes

Genetic Resources

[back to top]

See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource	Resource Type	Source	Notes/Reference
JW0401	Plasmid clone	Shigen	PMID:16769691 Status:Clone OK Primer 1:GCCAAAAAAACATTACTGGCAGC Primer 2:CCGAAGTTGTAACCTACTACCAG
4F3	Kohara Phage	Genobase	PMID:3038334
19F6	Kohara Phage	Genobase	PMID:3038334
zai-3053::Tn10	Linked marker	CAG18091 = CGSC7336^[5]	est. P1 cotransduction: 23% ^[6] Synonyms:zaj-3053::Tn10 nnnCAG18091 also carries proC9999 (CGSC).
zaj-3054::Tn10	Linked marker	CAG12017 = CGSC7339^[5]	est. P1 cotransduction: 33% ^[6] Synonyms:zba-3054::Tn10
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG11035	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG11035	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120001024	Escherichia coli str. K-12 substr. MG1655
NCBI (EcoliWiki Page)	GeneID:946242	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB1028	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0001425	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Product(s)

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name	Tsx
Synonyms	nucleoside channel, receptor of phage T6 and colicin K^[1], B0411^[2]^[1], NupA^[2]^[1], Tsx^[2]^[1] , ECK0405, JW0401, nupA, T6rec, b0411
Product description	nucleoside channel; receptor of phage T6 and colicin K^[2]^[3] Outer membrane channel for nucleosides; receptor for phage T6 and colicin K^[4]
EC number (for enzymes)
edit table

Notes

Function

[back to top]

<protect> Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier	GO ID	GO term name	Reference	Evidence Code	with/from	Aspect	Notes	Status
	GO:0005337	nucleoside transmembrane transporter activity	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR003055	F	Seeded from EcoCyc (v14.0)	complete
	GO:0005886	plasma membrane	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-1003	C	Seeded from EcoCyc (v14.0)	complete
	GO:0006810	transport	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0813	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006811	ion transport	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0406	P	Seeded from EcoCyc (v14.0)	complete
	GO:0009279	cell outer membrane	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR003055	C	Seeded from EcoCyc (v14.0)	complete
	GO:0009279	cell outer membrane	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR018013	C	Seeded from EcoCyc (v14.0)	complete
	GO:0009279	cell outer membrane	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0998	C	Seeded from EcoCyc (v14.0)	complete
	GO:0009597	detection of virus	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0580	P	Seeded from EcoCyc (v14.0)	complete
	GO:0016020	membrane	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0472	C	Seeded from EcoCyc (v14.0)	complete
	GO:0016021	integral to membrane	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0812	C	Seeded from EcoCyc (v14.0)	complete
	GO:0016021	integral to membrane	GO_REF:0000023	IEA: Inferred from Electronic Annotation	SP_SL:SL-9909	C	Seeded from EcoCyc (v14.0)	complete
	GO:0046718	entry of virus into host cell	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0580	P	Seeded from EcoCyc (v14.0)	complete
	GO:0046930	pore complex	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0626	C	Seeded from EcoCyc (v14.0)	complete
edit table

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type	Partner	Notes	References	Evidence
edit table

</protect>

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment	Evidence	Reference/Source
outer membrane		From EcoCyc^[3]
Outer Membrane	PMID:10806384	EchoLocation:tsx
edit table

Notes

Structure and Physical Properties

[back to top]

<protect> Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence	at EcoCyc MKKTLLAAGA VLALSSSFTV NAAENDKPQY LSDWWHQSVN VVGSYHTRFG PQIRNDTYLE YEAFAKKDWF DFYGYADAPV FFGGNSDAKG IWNHGSPLFM EIEPRFSIDK LTNTDLSFGP FKEWYFANNY IYDMGRNKDG RQSTWYMGLG TDIDTGLPMS LSMNVYAKYQ WQNYGAANEN EWDGYRFKIK YFVPITDLWG GQLSYIGFTN FDWGSDLGDD SGNAINGIKT RTNNSIASSH ILALNYDHWH YSVVARYWHD GGQWNDDAEL NFGNGNFNVR STGWGGYLVV GYNF
Length	294
Mol. Wt	33.589 kDa
pI	5.0 (calculated)
Extinction coefficient	108,290 (calc based on 21 Y, 14 W, and 0 C residues)
edit table

Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type	Residues	Description	Notes	References
motif	1-22	UniProt Manual:Signal Peptides	UniProt:P0A927
Domain	6..294	PF03502 Nucleoside-specific channel-forming protein, Tsx		PMID:19920124
edit table

<motif_map/>

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=tsx taxon=562,83333 </beststructure>

Models

View models at:

edit table

</protect>

Structure figures

</protect>

Notes

Gene Product Resources

[back to top]

See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type	Source	Notes/Reference
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
NCBI (Protein) (EcoliWiki Page)	GI:16128396	Escherichia coli str. K-12 substr. MG1655
NCBI (Protein) (EcoliWiki Page)	GeneID:946242	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0001425	Escherichia coli str. K-12 substr. MG1655
UniProt (EcoliWiki Page)	UniProtKB/Swiss-Prot:P0A927	Escherichia coli str. K-12 substr. MG1655
EcoCyc	EcoCyc:EG11035	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG11035	Escherichia coli str. K-12 substr. MG1655
NCBI (Gene) (EcoliWiki Page)	GeneID:946242	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120001024	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB1028	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Expression

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Cellular Levels

[back to top]

See Help:Cellular levels

Molecule	Organism or Strain	Value	Units	Experimental Conditions	Assay used	Reference(s)
Protein	E. coli K-12 MC4100	2.83E+03	molecules/cell	Medium: median data from rich and minimal media Temperature (°C): 37 Doubling time (min): Growth Rate(min): Growth phase: other:	emPAI	PMID:18304323
Protein	E. coli K-12 MG1655	14911	molecules/cell/generation	Medium: MOPS Complete Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	PMID: 24766808
Protein	E. coli K-12 MG1655	3927	molecules/cell/generation	Medium: MOPS Minimal Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	PMID: 24766808
Protein	E. coli K-12 MG1655	5253	molecules/cell/generation	Medium: MOPS Complete without Methionine Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	PMID: 24766808
edit table

Notes

Transcription and Transcriptional Regulation

[back to top]

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)
tsx
edit table

Figure courtesy of RegulonDB

</protect>

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]

<protect><gbrowseImage> name=NC_000913:431217..431257 source=MG1655 flip=1 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

</protect>

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]

<protect> Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name	Mutation	Phenotype	Reference
edit table

Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type	Reference	Notes
microarray	GEO Profiles:b0411 (EcoliWiki Page)	NCBI GEO profiles for tsx
microarray	GenExpDB:b0411 (EcoliWiki Page)	Summary of data for tsx from multiple microarray studies
edit table

Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name	Resource Type	Description	Source	Notes
edit table

Notes

Accessions Related to tsx Expression

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG11035	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB1028	Escherichia coli str. K-12 substr. MG1655
EcoliGenExpDB (EcoliWiki Page)	EcoliGenExpDB:b0411
EcoGene	EcoGene:EG11035	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120001024	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0001425	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Evolution

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]

See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism	Homologs (Statistics)	Comments
Shigella flexneri	TSX	From SHIGELLACYC
E. coli O157	TSX	From ECOO157CYC
edit table

Do-It-Yourself Web Tools

Notes

Families

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
Pfam (EcoliWiki Page)	PF03502 Nucleoside-specific channel-forming protein, Tsx
Superfamily (EcoliWiki Page)	SUPERFAMILY:111364
EcoCyc	EcoCyc:EG11035	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG11035	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120001024	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB1028	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0001425	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

References

[back to top]

See Help:References for how to manage references in EcoliWiki.

↑ ^1.0 ^1.1 ^1.2 ^1.3 ^1.4 ^1.5 ^1.6 ^1.7 ^1.8 ^1.9 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
↑ ^2.0 ^2.1 ^2.2 ^2.3 ^2.4 ^2.5 ^2.6 ^2.7 ^2.8 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^3.0 ^3.1 ^3.2 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^4.0 ^4.1 ^4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
↑ ^5.0 ^5.1 ^5.2 ^5.3 CGSC: The Coli Genetics Stock Center
↑ ^6.0 ^6.1 ^6.2 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

tsx:On One Page

Quickview

Notes

Gene

Nomenclature

Notes

Location(s) and DNA Sequence

Notes

Sequence Features

Notes

Alleles and Phenotypes

Notes

Genetic Interactions

Notes

Genetic Resources

Notes

Accessions in Other Databases

Notes

Links

Product(s)

Nomenclature

Notes

Function

Notes

Localization

Notes

Structure and Physical Properties

Structure figures

Notes

Gene Product Resources

Notes

Accessions in Other Databases

Notes

Links

Expression

Overview

Cellular Levels

Notes

Transcription and Transcriptional Regulation

Notes

Translation and Regulation of Translation

Notes

Turnover and Regulation of Turnover

Notes

Experimental

Notes

Accessions Related to tsx Expression

Notes

Links

Evolution

Homologs in Other Organisms

Do-It-Yourself Web Tools

Notes

Families

Notes

Links

References

Categories

Navigation menu

Search