trpE:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
trpE |
|---|---|
| Mnemonic |
Tryptophan |
| Synonyms | |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
28.44 minutes |
MG1655: 1320970..1319408 |
||
|
NC_012967: 1320540..1318978 |
||||
|
NC_012759: 1210257..1211819 |
||||
|
W3110 |
|
W3110: 1324660..1323098 |
||
|
DH10B: 1410366..1408804 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
1319408 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
trpE(del) (Keio:JW1256) |
deletion |
deletion |
|||||
|
trpEC13S |
C13S |
(in strain: TRPA2/COLVB) |
Strain variation; seeded from UniProt:P00895 | ||||
|
trpE81 |
|||||||
|
trpE38 |
|||||||
|
trpE3(Oc) |
Auxotrophies |
requires anthranilate, indole, or tryptophan for growth |
Smith and Yanofsky (1962)[6] |
ochre (UAA) mutation | |||
|
trpE9851(Oc) |
ochre (UAA) mutation | ||||||
|
trpE61 |
|||||||
|
trpE68 |
|||||||
|
trpE65(Oc) |
ochre (UAA) mutation | ||||||
|
trpE9829(Am) |
amber (UAG) mutation | ||||||
|
trpE63(del) |
|||||||
|
trpE10220 |
|||||||
|
trpE719(fbR) |
feedback resistant |
||||||
|
trpE9997 |
|||||||
|
trpE772(del)::kan |
|||||||
|
treP(del) |
deletion |
deletion |
Motility |
Deletion mutation increase motility compared to wild-type strain, figure 6. |
| ||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW1256 |
Plasmid clone |
Status:Clone OK Primer 1:GCCCAAACACAAAAACCGACTCT Primer 2:CCGAAAGTCTCCTGTGCATGATG | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 94% [14] | ||
|
Linked marker |
est. P1 cotransduction: 10% [14] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ Li, SL et al. (1974) Separation of anthranilate synthetase components I and II of Escherichia coli, Salmonella typhimurium, and Serratia marcescens and determination of their amino-terminal sequences by automatic Edman degradation. Biochemistry 13 1736-44 PubMed
- ↑ 4.0 4.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
- ↑ Smith, O.H. and C. Yanofsky (1962) Enzymes involved in the Biosynthesis of Tryptophan. Methods Enzymol. 5:794-806.
- ↑ Tully, M & Yudkin, MD (1977) Fine-structure mapping and complementation analysis of the Escherichia coli cysB gene. J. Bacteriol. 131 49-56 PubMed
- ↑ Yanofsky, C et al. (1971) Polarity and enzyme functions in mutants of the first three genes of the tryptophan operon of Escherichia coli. Genetics 69 409-33 PubMed
- ↑ Yanofsky, C & Ito, J (1966) Nonsense codons and polarity in the tryptophan operon. J. Mol. Biol. 21 313-34 PubMed
- ↑ Doolittle, WF & Yanofsky, C (1968) Mutants of Escherichia coli with an altered tryptophanyl-transfer ribonucleic acid synthetase. J. Bacteriol. 95 1283-94 PubMed
- ↑ Lee, J et al. (2007) Indole is an inter-species biofilm signal mediated by SdiA. BMC Microbiol. 7 42 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 13.0 13.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 14.0 14.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
