{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

On One Page

Quickview |

Gene |

Product(s) |

Expression|

Evolution |

References |

Quickview

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Standard Name	tpiA
Gene Synonym(s)	ECK3911, b3919, JW3890, tpi, G102^[1]^[2]
Product Desc.	triose phosphate isomerase^[2]^[3]; Component of triose phosphate isomerase^[2]^[3] Triosephosphate isomerase^[4]
Product Synonyms(s)	triosephosphate isomerase^[1], B3919^[2]^[1], Tpi^[2]^[1], TpiA^[2]^[1] , ECK3911, JW3890, tpi, b3919
Function from GO	<GO_nr />
Knock-Out Phenotype
Regulation/Expression	transcription unit(s): tpiA^[2]
Regulation/Activity
Quick Links
edit table

See Help:Quickview for help with entering information in the Quickview table.

Notes

[back to top]

Binds TrxA (Kumar, 2004).^[4]

Gene

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

[back to top]

See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name	tpiA
Mnemonic	Triose P isomerase
Synonyms	ECK3911, b3919, JW3890, tpi, G102^[1]^[2]
edit table

Notes

Location(s) and DNA Sequence

[back to top]

See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain	Map location	Genome coordinates	Genome browsers	Sequence links
MG1655	88.56 minutes, 88.56 minutes	MG1655: 4109530..4108763 <gbrowseImage> name=NC_000913:4108763..4109530 source=MG1655 preset=GeneLocation </gbrowseImage>	EcoCyc GBrowse(MG1655)	FASTA Dump EcoCyc Sequence Dump
REL606		NC_012967: 4090989..4090222 <gbrowseImage> name=NC_012967:4090222..4090989 source=REL606 preset=GeneLocation </gbrowseImage>	GBrowse (REL606)	FASTA Dump
BW2952		NC_012759: 3998432..3999199 <gbrowseImage> name=NC_012759:3998432..3999199 source=BW2952 preset=GeneLocation </gbrowseImage>	GBrowse (BW2952)	FASTA Dump
W3110		W3110: 3525174..3525941 <gbrowseImage> name=NC_007779:3525174..3525941 source=W3110 preset=GeneLocation </gbrowseImage>	GBrowse(W3110)	FASTA Dump
DH10B		DH10B: 4209227..4208460 <gbrowseImage> name=NC_010473:4208460..4209227 source=DH10B preset=GeneLocation </gbrowseImage>	GBrowse(DH10B)	FASTA Dump
edit table

Notes

Sequence Features

[back to top]

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type	Strain	Genomic Location	Evidence	Reference	Notes
Coding Start (SO:0000323)	MG1655	4108763	Edman degradation	PMID:8740179 PMID:9298646 PMID:9600841
edit table

Notes

Alleles and Phenotypes

[back to top]

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele	Nt change(s)	AA change(s)	Phenotype: Type	Phenotype: Description	Reference	Availability
ΔtpiA (Keio:JW3890)	deletion	deletion			PMID:16738554	Shigen CGSC10805^[5]
tpi			Auxotrophies	tpiA- mutants cannot grow on glucose or on carbon sources such as lactate, acetate, succinate, glycerol, rhamnose, ribose, xylose, which require gluconeogenesis.	PMID:11947134
tpiA1						CGSC:6261
tpiA3						CGSC:73767
ΔtpiA778::kan					PMID:16738554	CGSC:103192
edit table

Notes

Genetic Interactions

[back to top]

Interactor	Interaction	Allele	Score(s)	Reference(s)	Accessions	Notes
edit table

Notes

Genetic Resources

[back to top]

See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource	Resource Type	Source	Notes/Reference
JW3890	Plasmid clone	Shigen	PMID:16769691 Status:Clone OK Primer 1:GCCCGACATCCTTTAGTGATGGG Primer 2:CCAGCCTGTTTAGCCGCTTCTGC
4H12	Kohara Phage	Genobase	PMID:3038334
8B10	Kohara Phage	Genobase	PMID:3038334
zih-35::Tn10	Linked marker	CAG18495 = CGSC7467^[5]	est. P1 cotransduction: 14% ^[6]
pflD501::Tn10	Linked marker	CAG18477 = CGSC7470^[5]	est. P1 cotransduction: 25% ^[6] Synonyms:zij-501::Tn10 nnnCAG18477 also carries metF79(Am) (CGSC).
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG11015	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG11015	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120001004	Escherichia coli str. K-12 substr. MG1655
NCBI (EcoliWiki Page)	GeneID:948409	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB1008	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0012799	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Product(s)

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name	TpiA
Synonyms	triosephosphate isomerase^[1], B3919^[2]^[1], Tpi^[2]^[1], TpiA^[2]^[1] , ECK3911, JW3890, tpi, b3919
Product description	triose phosphate isomerase^[2]^[3]; Component of triose phosphate isomerase^[2]^[3] Triosephosphate isomerase^[4]
EC number (for enzymes)	5.3.1.1^[1]
edit table

Notes

Function

[back to top]

Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier	GO ID	GO term name	Reference	Evidence Code	with/from	Aspect	Notes	Status
	GO:0004807	triose-phosphate isomerase activity	PMID:6214548^[7]	IMP: Inferred from Mutant Phenotype		F		complete
	GO:0004807	triose-phosphate isomerase activity	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_00147	F	Seeded from EcoCyc (v14.0)	complete
	GO:0006094	gluconeogenesis	PMID:11947134^[8]	IMP: Inferred from Mutant Phenotype		P		complete
	GO:0004807	triose-phosphate isomerase activity	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR000652	F	Seeded from EcoCyc (v14.0)	complete
	GO:0004807	triose-phosphate isomerase activity	GOA:spec GO_REF:0000003	IEA: Inferred from Electronic Annotation	EC:5.3.1.1	F	Seeded from EcoCyc (v14.0)	complete
	GO:0005829	cytosol	PMID:16858726^[9]	IDA: Inferred from Direct Assay		C	Seeded from EcoCyc (v14.0)	complete
	GO:0006094	gluconeogenesis	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_00147	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006094	gluconeogenesis	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0312	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006096	glycolysis	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_00147	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006096	glycolysis	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0324	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006098	pentose-phosphate shunt	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_00147	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006098	pentose-phosphate shunt	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0570	P	Seeded from EcoCyc (v14.0)	complete
	GO:0016020	membrane	PMID:16858726^[9]	IDA: Inferred from Direct Assay		C	Seeded from EcoCyc (v14.0)	complete
	GO:0004807	triose-phosphate isomerase activity	PMID:6092857^[10]	ISA: Inferred from Sequence Alignment	UniProtKB:P00943	F		complete
edit table

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type	Partner	References	Evidence
Protein	Subunits of triose phosphate isomerase
Protein	manX	PMID:16606699^[11]	Experiment(s):EBI-1147023
Protein	fdhE	PMID:16606699^[11]	Experiment(s):EBI-1147023
Protein	fur	PMID:16606699^[11]	Experiment(s):EBI-1147023
Protein	ydfK	PMID:16606699^[11]	Experiment(s):EBI-1147023
Protein	prs	PMID:16606699^[11]	Experiment(s):EBI-1147023
Protein	argG	PMID:16606699^[11]	Experiment(s):EBI-1147023
Protein	rplQ	PMID:16606699^[11]	Experiment(s):EBI-1147023
Protein	waaU	PMID:16606699^[11]	Experiment(s):EBI-1147023
Protein	ynaE	PMID:16606699^[11]	Experiment(s):EBI-1147023
Protein	ybfL	PMID:16606699^[11]	Experiment(s):EBI-1147023
Protein	dnaK	PMID:15690043^[12]	Experiment(s):EBI-879853
Protein	entB	PMID:15690043^[12]	Experiment(s):EBI-884726
Protein	lysU	PMID:15690043^[12]	Experiment(s):EBI-884726
Protein	rpmB	PMID:15690043^[12]	Experiment(s):EBI-884726
Protein	rpoA	PMID:15690043^[12]	Experiment(s):EBI-884726
Protein	rpsB	PMID:15690043^[12]	Experiment(s):EBI-884726
Protein	rlmN	PMID:15690043^[12]	Experiment(s):EBI-884726
Protein	rlmN	PMID:19402753^[13]	LCMS(ID Probability):99.0
Protein	rpoA	PMID:19402753^[13]	LCMS(ID Probability):99.5
Protein	lysU	PMID:19402753^[13]	LCMS(ID Probability):99.6
Protein	yfiD	PMID:19402753^[13]	LCMS(ID Probability):99.0 MALDI(Z-score):37.692748
Protein	pepT	PMID:19402753^[13]	LCMS(ID Probability):99.0 MALDI(Z-score):36.843229
Protein	pflB	PMID:19402753^[13]	LCMS(ID Probability):99.0 MALDI(Z-score):38.165574
edit table

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment	Description	Evidence	Reference/Source	Notes
Cytosol
edit table

Notes

Structure and Physical Properties

[back to top]

Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence	at EcoCyc MRHPLVMGNW KLNGSRHMVH ELVSNLRKEL AGVAGCAVAI APPEMYIDMA KREAEGSHIM LGAQNVDLNL SGAFTGETSA AMLKDIGAQY IIIGHSERRT YHKESDELIA KKFAVLKEQG LTPVLCIGET EAENEAGKTE EVCARQIDAV LKTQGAAAFE GAVIAYEPVW AIGTGKSATP AQAQAVHKFI RDHIAKVDAN IAEQVIIQYG GSVNASNAAE LFAQPDIDGA LVGGASLKAD AFAVIVKAAE AAKQA
Length	255
Mol. Wt	26.971 kDa
pI	5.8 (calculated)
Extinction coefficient	18,450 - 18,825 (calc based on 5 Y, 2 W, and 3 C residues)
edit table

Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type	Residues	Description	Notes	References
Domain	4..246	PF00121 Triosephosphate isomerase		PMID:19920124^[14]
edit table

<motif_map/>

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=tpiA taxon=562,83333 </beststructure>

Models

View models at:

edit table

Structure figures

Notes

Gene Product Resources

[back to top]

See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type	Source	Notes/Reference
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
NCBI (Protein) (EcoliWiki Page)	GI:16131757	Escherichia coli str. K-12 substr. MG1655
NCBI (Protein) (EcoliWiki Page)	GeneID:948409	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0012799	Escherichia coli str. K-12 substr. MG1655
UniProt (EcoliWiki Page)	UniProtKB/Swiss-Prot:P0A858	Escherichia coli str. K-12 substr. MG1655
EcoCyc	EcoCyc:EG11015	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG11015	Escherichia coli str. K-12 substr. MG1655
NCBI (Gene) (EcoliWiki Page)	GeneID:948409	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120001004	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB1008	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Expression

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Cellular Levels

[back to top]

See Help:Cellular levels

Molecule	Organism or Strain	Value	Units	Experimental Conditions	Assay used	Notes	Reference(s)
Protein	E. coli K-12 MC4100	2.90E+04	molecules/cell	Medium: median data from rich and minimal media Temperature (°C): 37 Doubling time (min): Growth Rate(min): Growth phase: other:	emPAI		PMID:18304323
Protein	Ecoli K-12	767.928+/-3.779	Molecules/cell	Medium: Temperature (°C): Doubling time (min): Growth Rate(min): * Growth phase: other: *		Single Molecule Fluorescence	PMID:20671182
mRNA	Ecoli K-12	0.26567+/-0.00945	Molecules/cell	Medium: Temperature (°C): Doubling time (min): Growth Rate(min): * Growth phase: other: *		by FISH	PMID:20671182
mRNA	Ecoli K-12	0.548239896	Molecules/cell	Medium: Temperature (°C): Doubling time (min): Growth Rate(min): * Growth phase: other: *		by RNA_Seq	PMID:20671182
Protein	E. coli K-12 EMG2	1120	molecules/cell	Medium: MOPS glucose minimal Temperature (°C): 37 Doubling time (min): Growth phase: Exponential OD: OD600 = 0.2 to 0.25 other: aerated	Quantitative protein sequencing	Spot ID: M35	PMID: 9298646
Protein	E. coli K-12 MG1655	11959	molecules/cell/generation	Medium: MOPS Complete Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	7847	molecules/cell/generation	Medium: MOPS Minimal Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	6171	molecules/cell/generation	Medium: MOPS Complete without Methionine Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
edit table

Notes

Transcription and Transcriptional Regulation

[back to top]

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)
tpiA
edit table

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]

<gbrowseImage> name=NC_000913:4109510..4109550 source=MG1655 flip=1 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]

Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name	Mutation	Phenotype	Reference
edit table

Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type	Reference	Notes
microarray	GEO Profiles:b3919 (EcoliWiki Page)	NCBI GEO profiles for tpiA
microarray	GenExpDB:b3919 (EcoliWiki Page)	Summary of data for tpiA from multiple microarray studies
edit table

Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name	Resource Type	Description	Source	Notes
	GFP Fusion	Intergenic region (4108996..4109253) fused to gfpmut2.	OpenBioSystems	GFP fusion described in Zaslaver, et al. Plate:109-AZ01; Well:H7^[15]
edit table

Notes

Accessions Related to tpiA Expression

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG11015	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB1008	Escherichia coli str. K-12 substr. MG1655
EcoliGenExpDB (EcoliWiki Page)	EcoliGenExpDB:b3919
EcoGene	EcoGene:EG11015	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120001004	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0012799	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Evolution

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]

See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism	Homologs (Statistics)	Comments
Anopheles gambiae	ENSANGP00000018152 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Apis mellifera	ENSAPMP00000020502 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Arabidopsis thaliana	AT2G21170 (score: 1.000; bootstrap: 100%) AT3G55440 (score: 0.278)	From Inparanoid:20070104
Bos taurus	ENSBTAP00000026358 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Caenorhabditis briggsae	WBGene00039902 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Caenorhabditis elegans	WBGene00006601 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Canis familiaris	ENSCAFP00000021462 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Ciona intestinalis	ENSCINP00000013486 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Danio rerio	ZDB-GENE-020416-3 (score: 1.000; bootstrap: 100%) ZDB-CDNA-040425-931 (score: 1.000; bootstrap: 100%) ZDB-GENE-020416-4 (score: 0.757) ZDB-CDNA-040425-932 (score: 0.751)	From Inparanoid:20070104
Dictyostelium discoideum	DDB0231425 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Drosophila melanogaster	FBgn0003738 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Drosophila pseudoobscura	GA15281-PA (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Gallus gallus	ENSGALP00000023396 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Homo sapiens	ENSP00000229270 (score: 1.000; bootstrap: 100%) ENSP00000334713 (score: 0.939)	From Inparanoid:20070104
Macaca mulatta	ENSMMUP00000006872 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Monodelphis domestica	ENSMODP00000022631 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Mus musculus	MGI:98797 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Oryza gramene	P46225 (score: 1.000; bootstrap: 100%) Q69K00 (score: 0.726) Q9FS79 (score: 0.318) P12863 (score: 0.318) P46226 (score: 0.315) Q7F7B3 (score: 0.310) P48494 (score: 0.310) P34937 (score: 0.295) Q8LR75 (score: 0.287)	From Inparanoid:20070104
Pan troglodytes	ENSPTRP00000007852 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Rattus norvegicus	ENSRNOP00000039702 (score: 1.000; bootstrap: 100%) ENSRNOP00000048631 (score: 1.000; bootstrap: 100%) ENSRNOP00000020647 (score: 0.984)	From Inparanoid:20070104
Saccharomyces cerevisiae	YDR050C (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Schizosaccharomyces pombe	SPCC24B101 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Takifugu rubripes	NEWSINFRUP00000156180 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Tetraodon nigroviridis	GSTENP00005289001 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Xenopus tropicalis	ENSXETP00000049317 (score: 1.000; bootstrap: 87%)	From Inparanoid:20070104
Shigella flexneri	TPIA	From SHIGELLACYC
E. coli O157	TPIA	From ECOO157CYC
edit table

Do-It-Yourself Web Tools

Notes

Families

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
Superfamily (EcoliWiki Page)	SUPERFAMILY:51351
Panther (EcoliWiki Page)	PTHR21139:SF0
Pfam (EcoliWiki Page)	PF00121 Triosephosphate isomerase
EcoCyc	EcoCyc:EG11015	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG11015	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120001004	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB1008	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0012799	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

References

[back to top]

See Help:References for how to manage references in EcoliWiki.

↑ ^1.00 ^1.01 ^1.02 ^1.03 ^1.04 ^1.05 ^1.06 ^1.07 ^1.08 ^1.09 ^1.10 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
↑ ^2.00 ^2.01 ^2.02 ^2.03 ^2.04 ^2.05 ^2.06 ^2.07 ^2.08 ^2.09 ^2.10 ^2.11 ^2.12 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^3.0 ^3.1 ^3.2 ^3.3 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^4.0 ^4.1 ^4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
↑ ^5.0 ^5.1 ^5.2 CGSC: The Coli Genetics Stock Center
↑ ^6.0 ^6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
↑ Shimosaka, M et al. (1982) Application of hybrid plasmids carrying glycolysis genes to ATP production by Escherichia coli. J. Bacteriol. 152 98-103 PubMed
↑ Anderson, A & Cooper, RA (1969) Gluconeogenesis in Escherichia coli The role of triose phosphate isomerase. FEBS Lett. 4 19-20 PubMed
↑ ^9.0 ^9.1 Lasserre, JP et al. (2006) A complexomic study of Escherichia coli using two-dimensional blue native/SDS polyacrylamide gel electrophoresis. Electrophoresis 27 3306-21 PubMed
↑ Pichersky, E et al. (1984) Nucleotide sequence of the triose phosphate isomerase gene of Escherichia coli. Mol. Gen. Genet. 195 314-20 PubMed
↑ ^11.00 ^11.01 ^11.02 ^11.03 ^11.04 ^11.05 ^11.06 ^11.07 ^11.08 ^11.09 Arifuzzaman, M et al. (2006) Large-scale identification of protein-protein interaction of Escherichia coli K-12. Genome Res. 16 686-91 PubMed
↑ ^12.0 ^12.1 ^12.2 ^12.3 ^12.4 ^12.5 ^12.6 Butland, G et al. (2005) Interaction network containing conserved and essential protein complexes in Escherichia coli. Nature 433 531-7 PubMed
↑ ^13.0 ^13.1 ^13.2 ^13.3 ^13.4 ^13.5 Hu, P et al. (2009) Global functional atlas of Escherichia coli encompassing previously uncharacterized proteins. PLoS Biol. 7 e96 PubMed
↑ Finn, RD et al. (2010) The Pfam protein families database. Nucleic Acids Res. 38 D211-22 PubMed
↑ Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed

tpiA:On One Page

Quickview

Notes

Gene

Nomenclature

Notes

Location(s) and DNA Sequence

Notes

Sequence Features

Notes

Alleles and Phenotypes

Notes

Genetic Interactions

Notes

Genetic Resources

Notes

Accessions in Other Databases

Notes

Links

Product(s)

Nomenclature

Notes

Function

Notes

Localization

Notes

Structure and Physical Properties

Structure figures

Notes

Gene Product Resources

Notes

Accessions in Other Databases

Notes

Links

Expression

Overview

Cellular Levels

Notes

Transcription and Transcriptional Regulation

Notes

Translation and Regulation of Translation

Notes

Turnover and Regulation of Turnover

Notes

Experimental

Notes

Accessions Related to tpiA Expression

Notes

Links

Evolution

Homologs in Other Organisms

Do-It-Yourself Web Tools

Notes

Families

Notes

Links

References

Categories

Navigation menu

Search