topB:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
topB |
|---|---|
| Mnemonic |
Topoisomerase |
| Synonyms |
ECK1761, b1763, JW1752, mutR[1], mutR |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
39.72 minutes |
MG1655: 1844984..1843023 |
||
|
NC_012967: 1824188..1822227 |
||||
|
NC_012759: 1735082..1737043 |
||||
|
W3110 |
|
W3110: 1848674..1846713 |
||
|
DH10B: 1935555..1933594 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
1843023 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔtopB (Keio:JW1752) |
deletion |
||||||
|
topB::Tn5KAN-2 (FB20451) |
Insertion at nt 943 in Plus orientation |
contains pKD46 | |||||
|
topB77::Tn5 |
|||||||
|
ΔtopB761::kan |
|||||||
|
ΔtopB::aphA |
|||||||
|
ΔtopA ΔtopB |
Growth Phenotype |
|
depletion experiment- contained complementing topB expressing plasmid | ||||
|
ΔtopA ΔtopB ΔrecA |
|
complements the ΔtopA ΔtopB phenotype | |||||
|
ΔtopB::kan parE(ts) |
Growth Phenotype |
synthetically lethal |
|||||
|
ΔtopB::kan parC(ts) |
Growth Phenotype |
synthetically lethal |
|||||
|
ΔtopBruvC53 |
deletion |
Sensitivity to |
|
||||
|
ΔtopBΔtopA |
chromosomal segregation defect is due to a defect in recombination, not decatenation |
| |||||
| edit table |
<protect></protect>
Notes
topB is cool
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW1752 |
Plasmid clone |
Status:Clone OK Primer 1:GCCCGGTTGTTTATTGCCGAAAA Primer 2:CCgGCTATCGCCCCGCTTCCGAC | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 70% [10] | ||
|
Linked marker |
est. P1 cotransduction: 36% [10] | ||
|
pTBE302 |
Plasmid Clone |
| |
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ DiGate, RJ & Marians, KJ (1989) Molecular cloning and DNA sequence analysis of Escherichia coli topB, the gene encoding topoisomerase III. J. Biol. Chem. 264 17924-30 PubMed
- ↑ 3.0 3.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
- ↑ Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed
- ↑ 6.0 6.1 6.2 6.3 6.4 Zhu, Q et al. (2001) Type I topoisomerase activity is required for proper chromosomal segregation in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 98 9766-71 PubMed
- ↑ 7.0 7.1 7.2 Lopez, CR et al. (2005) A role for topoisomerase III in a recombination pathway alternative to RuvABC. Mol. Microbiol. 58 80-101 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 9.0 9.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 10.0 10.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).