thrC:On One Page

From EcoliWiki
Jump to: navigation, search

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Quickview | Gene | Product(s) | Expression| Evolution | References |

Quickview

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

<protect>

Standard Name

thrC

Gene Synonym(s)

ECK0004, b0004, JW0003[1], JW0003

Product Desc.

threonine synthase [2][3]

Threonine synthase[4]

Product Synonyms(s)

threonine synthase[1], B0004[2][1], ThrC[2][1] , ECK0004, JW0003, b0004

Function from GO

<GO_nr />

Knock-Out Phenotype
Regulation/Expression

transcription unit(s): thrLABC[2], OP00248, thr, thrABC

Regulation/Activity
Quick Links

porteco.png EcoCyc.gif regulondb.jpg

dnadisplay.png proteindisplay.png   pubmed.jpg   textpresso.jpg  

</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>

Notes

[back to top]





Gene

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css> <protect>

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

thrC

Mnemonic

Threonine

Synonyms

ECK0004, b0004, JW0003[1], JW0003

</protect>

Notes

Location(s) and DNA Sequence

[back to top]


<protect> See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

0.08 minutes 

MG1655: 3734..5020
<gbrowseImage> name=NC_000913:3734..5020 source=MG1655 preset=GeneLocation </gbrowseImage>

REL606

NC_012967: 3733..5019
<gbrowseImage> name=NC_012967:3733..5019 source=REL606 preset=GeneLocation </gbrowseImage>

BW2952

NC_012759: 3734..5020
<gbrowseImage> name=NC_012759:3734..5020 source=BW2952 preset=GeneLocation </gbrowseImage>

W3110

 

W3110: 3734..5020
<gbrowseImage> name=NC_007779:3734..5020 source=W3110 preset=GeneLocation </gbrowseImage>

DH10B

DH10B: 3734..5020
<gbrowseImage> name=NC_010473:3734..5020 source=DH10B preset=GeneLocation </gbrowseImage>

</protect>

Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

3734

Edman degradation

PMID:9298646
PMID:9600841
PMID:9740056


<protect></protect>

Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

ΔthrC (Keio:JW0003)

deletion

deletion

PMID:16738554

Shigen
CGSC8334[5]

thrC1001

CGSC:5877

ΔthrC724::kan

PMID:16738554

CGSC:103152


<protect></protect>

Notes

Genetic Interactions

[back to top]


<protect>

Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

</protect>

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW0003

Plasmid clone

Shigen

PMID:16769691

Status:Clone OK

Primer 1:GCCAAACTCTACAATCTGAAAGA

Primer 2:CCCTGATGATTCATCATCAATTT

9E4

Kohara Phage

Genobase

PMID:3038334

15A5

Kohara Phage

Genobase

PMID:3038334

thrA34::Tn10

Linked marker

CAG18442 = CGSC7320[5]

est. P1 cotransduction: 88% [6]
Synonyms:thr-34::Tn10

carB96::Tn10

Linked marker

CAG12093 = CGSC7322[5]

est. P1 cotransduction: 33% [6]
Synonyms:car-96::Tn10

<protect></protect>

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG11000

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG11000

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000989

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:945198

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0993

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0000012

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]



Product(s)

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name

ThrC

Synonyms

threonine synthase[1], B0004[2][1], ThrC[2][1] , ECK0004, JW0003, b0004

Product description

threonine synthase [2][3]

Threonine synthase[4]

EC number (for enzymes)

4.2.3.1[1]

<protect></protect>

Notes

Function

[back to top]


<protect> Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier GO ID GO term name Reference Evidence Code with/from Aspect Notes Status

GO:0004795

threonine synthase activity

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR004450

F

Seeded from EcoCyc (v14.0)

complete

GO:0004795

threonine synthase activity

GOA:spec
GO_REF:0000003

IEA: Inferred from Electronic Annotation

EC:4.2.3.1

F

Seeded from EcoCyc (v14.0)

complete

GO:0009088

threonine biosynthetic process

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR004450

P

Seeded from EcoCyc (v14.0)

complete

GO:0009088

threonine biosynthetic process

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0791

P

Seeded from EcoCyc (v14.0)

complete

GO:0030170

pyridoxal phosphate binding

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR000634

F

Seeded from EcoCyc (v14.0)

complete

GO:0030170

pyridoxal phosphate binding

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR001926

F

Seeded from EcoCyc (v14.0)

complete

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type Partner Notes References Evidence

Protein

fusA

PMID:16606699

Experiment(s):EBI-1135301

Protein

rpmB

PMID:19402753

LCMS(ID Probability):99.6

Protein

hns

PMID:19402753

LCMS(ID Probability):99.6

Protein

hdeB

PMID:19402753

LCMS(ID Probability):99.6

</protect>

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment Description Evidence Reference/Source Notes

<protect></protect>

Notes

Structure and Physical Properties

[back to top]


<protect> Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence

at EcoCyc

MKLYNLKDHN EQVSFAQAVT QGLGKNQGLF FPHDLPEFSL TEIDEMLKLD FVTRSAKILS
AFIGDEIPQE ILEERVRAAF AFPAPVANVE SDVGCLELFH GPTLAFKDFG GRFMAQMLTH
IAGDKPVTIL TATSGDTGAA VAHAFYGLPN VKVVILYPRG KISPLQEKLF CTLGGNIETV
AIDGDFDACQ ALVKQAFDDE ELKVALGLNS ANSINISRLL AQICYYFEAV AQLPQETRNQ
LVVSVPSGNF GDLTAGLLAK SLGLPVKRFI AATNVNDTVP RFLHDGQWSP KATQATLSNA
MDVSQPNNWP RVEELFRRKI WQLKELGYAA VDDETTQQTM RELKELGYTS EPHAAVAYRA
LRDQLNPGEY GLFLGTAHPA KFKESVEAIL GETLDLPKEL AERADLPLLS HNLPADFAAL
RKLMMNHQ
Length

428

Mol. Wt

47.114 kDa

pI

5.2 (calculated)

Extinction coefficient

29,910 - 30,410 (calc based on 9 Y, 3 W, and 4 C residues)


Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type Residues Description Notes References

Domain

94..374

PF00291 Pyridoxal-phosphate dependent enzyme

PMID:19920124

<motif_map/>

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=thrC taxon=562,83333 </beststructure>

Models

View models at:

</protect>

Structure figures

<protect>

</protect>

Notes

Gene Product Resources

[back to top]


See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type Source Notes/Reference

<protect></protect>

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

NCBI (Protein) (EcoliWiki Page)

GI:16127998

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0000012

Escherichia coli str. K-12 substr. MG1655

UniProt (EcoliWiki Page)

UniProtKB:P00934

Escherichia coli str. K-12 substr. MG1655

EcoCyc

EcoCyc:EG11000

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG11000

Escherichia coli str. K-12 substr. MG1655

NCBI (Gene) (EcoliWiki Page)

GeneID:945198

Escherichia coli str. K-12 substr. MG1655

NCBI (Protein) (EcoliWiki Page)

GeneID:945198

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000989

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0993

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]




Expression

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.


Cellular Levels

[back to top]


See Help:Cellular levels

Molecule Organism or Strain Value Units Experimental Conditions Assay used Notes Reference(s)

Protein

E. coli K-12 MC4100

1.04E+03

molecules/cell

  • Medium: median data from rich and minimal media
  • Temperature (°C): 37
  • Doubling time (min): Growth Rate(min):
  • Growth phase: other:

emPAI

PMID:18304323

Protein

E. coli K-12 EMG2

560

molecules/cell

  • Medium: MOPS glucose minimal
  • Temperature (°C): 37
  • Doubling time (min):
  • Growth phase: Exponential
  • OD: OD600 = 0.2 to 0.25
  • other: aerated

Quantitative protein sequencing

Spot ID: M73

PMID: 9298646

Protein

E. coli K-12 MG1655

4879

molecules/cell/generation

  • Medium: MOPS Complete
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Protein

E. coli K-12 MG1655

5880

molecules/cell/generation

  • Medium: MOPS Minimal
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Protein

E. coli K-12 MG1655

4995

molecules/cell/generation

  • Medium: MOPS Complete without Methionine
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Notes

Transcription and Transcriptional Regulation

[back to top]


<protect>

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)

thrLABC

Figure courtesy of RegulonDB

</protect>

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]


<protect><gbrowseImage> name=NC_000913:3714..3754 source=MG1655 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

</protect>

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]


<protect> Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name Mutation Phenotype Reference


Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type Reference Notes

microarray

GEO Profiles:b0004 (EcoliWiki Page)

NCBI GEO profiles for thrC

microarray

GenExpDB:b0004 (EcoliWiki Page)

Summary of data for thrC from multiple microarray studies


Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name Resource Type Description Source Notes

<protect></protect>

Notes

Accessions Related to thrC Expression

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG11000

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0993

Escherichia coli str. K-12 substr. MG1655

EcoliGenExpDB (EcoliWiki Page)

EcoliGenExpDB:b0004

EcoGene

EcoGene:EG11000

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000989

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0000012

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]



Evolution

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]


See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism Homologs (Statistics) Comments

Arabidopsis thaliana

  • AT4G29840 (score: 1.000; bootstrap: 100%)
  • AT1G72810 (score: 0.739)

From Inparanoid:20070104

Bos taurus

  • ENSBTAP00000005725 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Canis familiaris

  • ENSCAFP00000011010 (score: 1.000; bootstrap: 59%)

From Inparanoid:20070104

Ciona intestinalis

  • ENSCINP00000010207 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Danio rerio

  • ZDB-GENE-051127-19 (score: 1.000; bootstrap: 100%)
  • ZDB-CDNA-051127-11 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Gallus gallus

  • ENSGALP00000012431 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Homo sapiens

  • ENSP00000328525 (score: 1.000; bootstrap: 56%)

From Inparanoid:20070104

Macaca mulatta

  • ENSMMUP00000026690 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Monodelphis domestica

  • ENSMODP00000011995 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Mus musculus

  • MGI:2139347 (score: 1.000; bootstrap: 50%)

From Inparanoid:20070104

Oryza gramene

  • Q6L4H5 (score: 1.000; bootstrap: 100%)
  • Q8LJJ2 (score: 0.864)

From Inparanoid:20070104

Pan troglodytes

  • ENSPTRP00000004007 (score: 1.000; bootstrap: 51%)

From Inparanoid:20070104

Rattus norvegicus

  • ENSRNOP00000008698 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Saccharomyces cerevisiae

  • YCR053W (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Schizosaccharomyces pombe

  • SPAC9E96c (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Takifugu rubripes

  • NEWSINFRUP00000155654 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Tetraodon nigroviridis

  • GSTENP00025503001 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Xenopus tropicalis

  • ENSXETP00000004122 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Shigella flexneri

THRC

From SHIGELLACYC

E. coli O157

THRC

From ECOO157CYC


Do-It-Yourself Web Tools

<protect></protect>

Notes

Families

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

Pfam (EcoliWiki Page)

PF00291 Pyridoxal-phosphate dependent enzyme

Panther (EcoliWiki Page)

PTHR10314:SF5

Superfamily (EcoliWiki Page)

SUPERFAMILY:53686

EcoCyc

EcoCyc:EG11000

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG11000

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000989

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0993

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0000012

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]



References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. 2.0 2.1 2.2 2.3 2.4 2.5 2.6 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  3. 3.0 3.1 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  4. 4.0 4.1 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
  5. 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
  6. 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories

[back to top]