thrC:Gene

From EcoliWiki
Jump to: navigation, search

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

<protect>

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

thrC

Mnemonic

Threonine

Synonyms

ECK0004, b0004, JW0003[1], JW0003

</protect>

Notes

Location(s) and DNA Sequence

[back to top]


<protect> See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

0.08 minutes 

MG1655: 3734..5020
<gbrowseImage> name=NC_000913:3734..5020 source=MG1655 preset=GeneLocation </gbrowseImage>

REL606

NC_012967: 3733..5019
<gbrowseImage> name=NC_012967:3733..5019 source=REL606 preset=GeneLocation </gbrowseImage>

BW2952

NC_012759: 3734..5020
<gbrowseImage> name=NC_012759:3734..5020 source=BW2952 preset=GeneLocation </gbrowseImage>

W3110

 

W3110: 3734..5020
<gbrowseImage> name=NC_007779:3734..5020 source=W3110 preset=GeneLocation </gbrowseImage>

DH10B

DH10B: 3734..5020
<gbrowseImage> name=NC_010473:3734..5020 source=DH10B preset=GeneLocation </gbrowseImage>

</protect>

Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

3734

Edman degradation

PMID:9298646[2]
PMID:9600841[3]
PMID:9740056[4]


<protect></protect>

Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

ΔthrC (Keio:JW0003)

deletion

deletion

PMID:16738554[5]

Shigen
CGSC8334[6]

thrC1001

CGSC:5877

ΔthrC724::kan

PMID:16738554[5]

CGSC:103152


<protect></protect>

Notes

Genetic Interactions

[back to top]


<protect>

Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

</protect>

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW0003

Plasmid clone

Shigen

PMID:16769691[7]

Status:Clone OK

Primer 1:GCCAAACTCTACAATCTGAAAGA

Primer 2:CCCTGATGATTCATCATCAATTT

9E4

Kohara Phage

Genobase

PMID:3038334[8]

15A5

Kohara Phage

Genobase

PMID:3038334[8]

thrA34::Tn10

Linked marker

CAG18442 = CGSC7320[6]

est. P1 cotransduction: 88% [9]
Synonyms:thr-34::Tn10

carB96::Tn10

Linked marker

CAG12093 = CGSC7322[6]

est. P1 cotransduction: 33% [9]
Synonyms:car-96::Tn10

<protect></protect>

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG11000

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG11000

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000989

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:945198

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0993

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0000012

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. Link, AJ et al. (1997) Comparing the predicted and observed properties of proteins encoded in the genome of Escherichia coli K-12. Electrophoresis 18 1259-313 PubMed
  3. Wilkins, MR et al. (1998) Protein identification with N and C-terminal sequence tags in proteome projects. J. Mol. Biol. 278 599-608 PubMed
  4. Tonella, L et al. (1998) '98 Escherichia coli SWISS-2DPAGE database update. Electrophoresis 19 1960-71 PubMed
  5. 5.0 5.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
  6. 6.0 6.1 6.2 CGSC: The Coli Genetics Stock Center
  7. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
  8. 8.0 8.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
  9. 9.0 9.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories