sodB:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
| Standard Name |
sodB |
|---|---|
| Gene Synonym(s) |
ECK1652, b1656, JW1648[1], JW1648 |
| Product Desc. |
Component of superoxide dismutase (Fe)[2][3] Superoxide dismutase, Fe; response to oxidative stress; chromate resistance; negatively regulated by ryhB RNA as part of indirect positive regulation by Fur; acid-inducible[4] |
| Product Synonyms(s) |
superoxide dismutase, Fe[1], B1656[2][1], SodB[2][1] , ECK1652, JW1648, b1656 |
| Function from GO |
<GO_nr /> |
| Knock-Out Phenotype | |
| Regulation/Expression | |
| Regulation/Activity | |
| Quick Links | |
| edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
sodB |
|---|---|
| Mnemonic |
SuperOxide Dismutase |
| Synonyms |
ECK1652, b1656, JW1648[1], JW1648 |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
37.36 minutes |
MG1655: 1733402..1733983 |
||
|
NC_012967: 1712572..1713153 |
||||
|
NC_012759: 1625461..1626042 |
||||
|
W3110 |
|
W3110: 1737092..1737673 |
||
|
DH10B: 1823973..1824554 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
1733405 |
Edman degradation |
PMID:2447093 |
| |
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔsodB (Keio:JW1648) |
deletion |
deletion |
PMID:16738554 |
||||
|
sodB::Tn5KAN-I-SceI (FB20409) |
Insertion at nt 343 in Plus orientation |
PMID:15262929 |
contains pKD46 | ||||
|
ΔsodB734::kan |
PMID:16738554 |
| |||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW1648 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCTCATTCGAATTACCTGCACT Primer 2:CCTGCAGCGAGATTTTTCGCTAC | |
|
Kohara Phage |
PMID:3038334 | ||
|
Kohara Phage |
PMID:3038334 | ||
|
Kohara Phage |
PMID:3038334 | ||
|
Linked marker |
est. P1 cotransduction: % [6] | ||
|
zdi-925::Tn10 |
Linked marker |
est. P1 cotransduction: 15% [6] | |
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG10954 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10954 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120000943 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EchoBASE:EB0947 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0005537 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
| Standard name |
SodB |
|---|---|
| Synonyms |
superoxide dismutase, Fe[1], B1656[2][1], SodB[2][1] , ECK1652, JW1648, b1656 |
| Product description |
Component of superoxide dismutase (Fe)[2][3] Superoxide dismutase, Fe; response to oxidative stress; chromate resistance; negatively regulated by ryhB RNA as part of indirect positive regulation by Fur; acid-inducible[4] |
| EC number (for enzymes) | |
| edit table |
<protect></protect>
Notes
Paraquat (methyl viologen) & plumbagin generate superoxide.
6-phosphogluconate dehydratase, dihydroxyacid dehydratase, quinolinate synthase, and aconitase are considered to be superoxide sensitive enzymes[7] [8] [9] [10].
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
| Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
|---|---|---|---|---|---|---|---|---|
|
GO:0004784 |
superoxide dismutase activity |
PMID:4352182 |
IDA: Inferred from Direct Assay |
F |
complete | |||
|
GO:0005737 |
cytoplasm |
PMID:330499 |
IDA: Inferred from Direct Assay |
C |
Although SodB was previously localized to the periplasmic space, this was shown to be incorrect by the methods used in this paper (spheroplast formation, osmotic shock & addition of diazo-NDS, an inhibitory reagent that cannot cross the inner membrane). |
complete | ||
|
GO:0004784 |
superoxide dismutase activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR001189 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0005506 |
iron ion binding |
PMID:11669646 |
IPI: Inferred from Physical Interaction |
F |
Missing: with/from | |||
|
GO:0004784 |
superoxide dismutase activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR019831 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0046872 |
metal ion binding |
PMID:11669646 |
IPI: Inferred from Physical Interaction |
F |
Missing: with/from | |||
|
GO:0004784 |
superoxide dismutase activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR019832 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0004784 |
superoxide dismutase activity |
PMID:1447175 |
IDA: Inferred from Direct Assay |
F |
complete | |||
|
GO:0004784 |
superoxide dismutase activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR019833 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0000303 |
response to superoxide |
PMID:1447175 |
IDA: Inferred from Direct Assay |
P |
complete | |||
|
GO:0004784 |
superoxide dismutase activity |
GOA:spec |
IEA: Inferred from Electronic Annotation |
EC:1.15.1.1 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0016491 |
oxidoreductase activity |
PMID:1447175 |
IDA: Inferred from Direct Assay |
F |
complete | |||
|
GO:0005506 |
iron ion binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0408 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006801 |
superoxide metabolic process |
PMID:1447175 |
IDA: Inferred from Direct Assay |
P |
complete | |||
|
GO:0005829 |
cytosol |
PMID:16858726 |
IDA: Inferred from Direct Assay |
C |
Seeded from EcoCyc (v14.0) |
complete | ||
|
GO:0055114 |
oxidation reduction |
PMID:1447175 |
IDA: Inferred from Direct Assay |
P |
complete | |||
|
GO:0006801 |
superoxide metabolic process |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR001189 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0019430 |
removal of superoxide radicals |
PMID:1447175 |
IDA: Inferred from Direct Assay |
P |
complete | |||
|
GO:0006801 |
superoxide metabolic process |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR019831 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0000303 |
response to superoxide |
PMID:3022287 |
IMP: Inferred from Mutant Phenotype |
P |
complete | |||
|
GO:0006801 |
superoxide metabolic process |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR019832 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
Contributes to |
GO:0004784 |
superoxide dismutase activity |
PMID:3022287 |
IMP: Inferred from Mutant Phenotype |
F |
complete | ||
|
GO:0006801 |
superoxide metabolic process |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR019833 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006801 |
superoxide metabolic process |
PMID:3022287 |
IMP: Inferred from Mutant Phenotype |
P |
complete | |||
|
GO:0016020 |
membrane |
PMID:16858726 |
IDA: Inferred from Direct Assay |
C |
Seeded from EcoCyc (v14.0) |
complete | ||
|
GO:0055114 |
oxidation reduction |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR001189 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0055114 |
oxidation reduction |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR019831 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0055114 |
oxidation reduction |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR019832 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0055114 |
oxidation reduction |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR019833 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0055114 |
oxidation reduction |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0560 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
| edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
| Partner Type | Partner | Notes | References | Evidence |
|---|---|---|---|---|
|
Protein |
Subunits of superoxide dismutase (Fe) |
could be indirect |
||
|
Protein |
evgA |
PMID:16606699 |
Experiment(s):EBI-1140393 | |
|
Protein |
ygaE |
PMID:16606699 |
Experiment(s):EBI-1140393 | |
|
Protein |
rplB |
PMID:16606699 |
Experiment(s):EBI-1140393 | |
|
Protein |
slyD |
PMID:16606699 |
Experiment(s):EBI-1140393 | |
|
Protein |
pal |
PMID:16606699 |
Experiment(s):EBI-1140393 | |
|
Protein |
Fur |
sodB is positively regulated by Fur |
11917098 |
|
| edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
| Compartment | Description | Evidence | Reference/Source | Notes |
|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
| Name | |
|---|---|
| Sequence |
MSFELPALPY AKDALAPHIS AETIEYHYGK HHQTYVTNLN NLIKGTAFEG KSLEEIIRSS EGGVFNNAAQ VWNHTFYWNC LAPNAGGEPT GKVAEAIAAS FGSFADFKAQ FTDAAIKNFG SGWTWLVKNS DGKLAIVSTS NAGTPLTTDA TPLLTVDVWE HAYYIDYRNA RPGYLEHFWA LVNWEFVAKN LAA |
| Length |
193 |
| Mol. Wt |
21.265 kDa |
| pI |
5.9 (calculated) |
| Extinction coefficient |
51,910 - 52,035 (calc based on 9 Y, 7 W, and 1 C residues) |
| edit table |
Domains/Motifs/Modification Sites
|
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
|
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
| Resource type | Source | Notes/Reference |
|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
ASAP:ABE-0005537 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EcoCyc:EG10954 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10954 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
RegulonDB:ECK120000943 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB0947 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
| Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
|---|---|---|---|---|---|---|---|
|
Protein |
E. coli K-12 MC4100 |
5.85E+03 |
molecules/cell |
|
emPAI |
PMID:18304323 | |
|
Protein |
E. coli K-12 EMG2 |
2020 |
molecules/cell |
|
Quantitative protein sequencing |
Spot ID: M36 |
PMID: 9298646 |
|
Protein |
E. coli K-12 MG1655 |
33494 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
15086 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
20640 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
| edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
|
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
Figure courtesy of RegulonDB |
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:1733382..1733422
source=MG1655
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
| Allele Name | Mutation | Phenotype | Reference |
|---|---|---|---|
| edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
| Type | Reference | Notes |
|---|---|---|
|
microarray |
NCBI GEO profiles for sodB | |
|
microarray |
Summary of data for sodB from multiple microarray studies | |
| edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
| Resource Name | Resource Type | Description | Source | Notes |
|---|---|---|---|---|
|
GFP Fusion |
Intergenic region (1733174..1733479) fused to gfpmut2. |
GFP fusion described in Zaslaver, et al. | ||
| edit table |
<protect></protect>
Notes
Accessions Related to sodB Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG10954 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB0947 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10954 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120000943 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0005537 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
| Organism | Homologs (Statistics) | Comments |
|---|---|---|
|
Apis mellifera |
|
From Inparanoid:20070104 |
|
Arabidopsis thaliana |
|
From Inparanoid:20070104 |
|
Bos taurus |
|
From Inparanoid:20070104 |
|
Macaca mulatta |
|
From Inparanoid:20070104 |
|
Oryza gramene |
|
From Inparanoid:20070104 |
|
Xenopus tropicalis |
|
From Inparanoid:20070104 |
|
Shigella flexneri |
SODB |
From SHIGELLACYC |
|
E. coli O157 |
SODB |
From ECOO157CYC |
| edit table |
Do-It-Yourself Web Tools
<protect></protect>
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
PF00081 Iron/manganese superoxide dismutases, alpha-hairpin domain |
||
|
PF02777 Iron/manganese superoxide dismutases, C-terminal domain |
||
|
EcoCyc:EG10954 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10954 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120000943 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB0947 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0005537 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 2.2 2.3 2.4 2.5 2.6 2.7 2.8 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 3.2 3.3 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ Gardner, PR & Fridovich, I (1991) Superoxide sensitivity of the Escherichia coli 6-phosphogluconate dehydratase. J. Biol. Chem. 266 1478-83 PubMed
- ↑ Gardner, PR & Fridovich, I (1991) Superoxide sensitivity of the Escherichia coli aconitase. J. Biol. Chem. 266 19328-33 PubMed
- ↑ Gardner, PR & Fridovich, I (1991) Quinolinate synthetase: the oxygen-sensitive site of de novo NAD(P)+ biosynthesis. Arch. Biochem. Biophys. 284 106-11 PubMed
- ↑ Kuo, CF et al. (1987) alpha, beta-Dihydroxyisovalerate dehydratase. A superoxide-sensitive enzyme. J. Biol. Chem. 262 4724-7 PubMed
- ↑ Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed
Categories
- Genes in OpenBioSystems with Promoter Fusions
- Genes with homologs in Apis mellifera
- Genes with homologs in Arabidopsis thaliana
- Genes with homologs in Bos taurus
- Genes with homologs in Macaca mulatta
- Genes with homologs in Oryza gramene
- Genes with homologs in Xenopus tropicalis
- Genes with homologs in Shigella flexneri
- Genes with homologs in E. coli O157


