{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

On One Page

Quickview |

Gene |

Product(s) |

Expression|

Evolution |

References |

Quickview

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Standard Name	slyD
Gene Synonym(s)	ECK3336, b3349, JW3311^[1], JW3311
Product Desc.	FKBP-type rotamase, peptidyl prolyl cis-trans isomerase^[2]; FKBP-type peptidyl prolyl cis-trans isomerase^[3]; Component of FKBP-type peptidyl prolyl cis-trans isomerase^[3] FKBP-type peptidyl-prolyl cis-trans isomerase; metal ion regulated; overexpression causes filamentation; required to stabilize E lysis protein of bacteriophage phiX174^[4]
Product Synonyms(s)	FKBP-type peptidyl prolyl cis-trans isomerase (rotamase)^[1], B3349^[2]^[1], SlyD^[2]^[1], WHP^[2]^[1] , ECK3336, JW3311, b3349
Function from GO	<GO_nr />
Knock-Out Phenotype
Regulation/Expression	transcription unit(s): slyD^[2]
Regulation/Activity
Quick Links
edit table

See Help:Quickview for help with entering information in the Quickview table.

Notes

[back to top]

HypB requires binding of SlyD for hydrogenase activity as SlyD helps facilitate nickel insertion. Binds TrxA (Kumar, 2004). SlyD has a histidine-rich, nickel-binding region, so it is a common contaminant in protein purification of His-tagged proteins (Parsy, 2007). SlyD is a a heat-shock protein that facilitates folding and enhances the solubilty of aggregation-prone proteins (Han, 2007).^[4]

Gene

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

[back to top]

See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name	slyD
Mnemonic	Sensitivity to lysis
Synonyms	ECK3336, b3349, JW3311^[1], JW3311
edit table

Notes

Location(s) and DNA Sequence

[back to top]

See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain	Map location	Genome coordinates	Genome browsers	Sequence links
MG1655	74.92 minutes, 74.92 minutes	MG1655: 3476519..3475929 <gbrowseImage> name=NC_000913:3475929..3476519 source=MG1655 preset=GeneLocation </gbrowseImage>	EcoCyc GBrowse(MG1655)	FASTA Dump EcoCyc Sequence Dump
REL606		NC_012967: 3406402..3405812 <gbrowseImage> name=NC_012967:3405812..3406402 source=REL606 preset=GeneLocation </gbrowseImage>	GBrowse (REL606)	FASTA Dump
BW2952		NC_012759: 3363086..3363676 <gbrowseImage> name=NC_012759:3363086..3363676 source=BW2952 preset=GeneLocation </gbrowseImage>	GBrowse (BW2952)	FASTA Dump
W3110		W3110: 4161919..4162509 <gbrowseImage> name=NC_007779:4161919..4162509 source=W3110 preset=GeneLocation </gbrowseImage>	GBrowse(W3110)	FASTA Dump
DH10B		DH10B: 3574264..3573674 <gbrowseImage> name=NC_010473:3573674..3574264 source=DH10B preset=GeneLocation </gbrowseImage>	GBrowse(DH10B)	FASTA Dump
edit table

Notes

Sequence Features

[back to top]

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type	Strain	Genomic Location	Evidence	Reference	Notes
Coding Start (SO:0000323)	MG1655	3475929	Edman degradation	PMID:8300624 PMID:9188461
edit table

Notes

Alleles and Phenotypes

[back to top]

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele	Nt change(s)	AA change(s)	Reference	Availability
ΔslyD (Keio:JW3311)	deletion	deletion	PMID:16738554	Shigen CGSC8289^[5]
ΔslyD738::kan			PMID:16738554	CGSC:93041
edit table

Notes

Genetic Interactions

[back to top]

Interactor	Interaction	Allele	Score(s)	Reference(s)	Accessions	Notes
edit table

Notes

Genetic Resources

[back to top]

See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource	Resource Type	Source	Notes/Reference
JW3311	Plasmid clone	Shigen	PMID:16769691 Status:Clone OK Primer 1:GCCAAAGTAGCAAAAGACCTGGT Primer 2:CCGTGGCAACCGCAACCGCCGTT
4C5	Kohara Phage	Genobase	PMID:3038334
3F8	Kohara Phage	Genobase	PMID:3038334
smg-3082::Tn10	Linked marker	CAG12071 = CGSC7444^[5]	est. P1 cotransduction: 12% ^[6] Synonyms:zhb-3082::Tn10, zhd-3082::Tn10
zhf-3084::Tn10	Linked marker	CAG18456 = CGSC7576^[5]	est. P1 cotransduction: 36% ^[6] Synonyms:zhe-3084::Tn10nnnCAG18456 also carries cysG0 (CGSC).
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG11663	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG11663	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120001606	Escherichia coli str. K-12 substr. MG1655
NCBI (EcoliWiki Page)	GeneID:947859	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB1614	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0010946	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Product(s)

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name	SlyD
Synonyms	FKBP-type peptidyl prolyl cis-trans isomerase (rotamase)^[1], B3349^[2]^[1], SlyD^[2]^[1], WHP^[2]^[1] , ECK3336, JW3311, b3349
Product description	FKBP-type rotamase, peptidyl prolyl cis-trans isomerase^[2]; FKBP-type peptidyl prolyl cis-trans isomerase^[3]; Component of FKBP-type peptidyl prolyl cis-trans isomerase^[3] FKBP-type peptidyl-prolyl cis-trans isomerase; metal ion regulated; overexpression causes filamentation; required to stabilize E lysis protein of bacteriophage phiX174^[4]
EC number (for enzymes)	5.2.1.8^[1]
edit table

Notes

Function

[back to top]

Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier	GO ID	GO term name	Reference	Evidence Code	with/from	Aspect	Notes	Status
	GO:0003755	peptidyl-prolyl cis-trans isomerase activity	GOA:spec GO_REF:0000003	IEA: Inferred from Electronic Annotation	EC:5.2.1.8	F	Seeded from EcoCyc (v14.0)	complete
	GO:0003755	peptidyl-prolyl cis-trans isomerase activity	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0697	F	Seeded from EcoCyc (v14.0)	complete
	GO:0005507	copper ion binding	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0186	F	Seeded from EcoCyc (v14.0)	complete
	GO:0005737	cytoplasm	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0963	C	Seeded from EcoCyc (v14.0)	complete
	GO:0005737	cytoplasm	GO_REF:0000023	IEA: Inferred from Electronic Annotation	SP_SL:SL-0086	C	Seeded from EcoCyc (v14.0)	complete
	GO:0008270	zinc ion binding	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0862	F	Seeded from EcoCyc (v14.0)	complete
	GO:0008270	zinc ion binding	PMID:8300624^[7]	IDA: Inferred from Direct Assay		F	Seeded from EcoCyc (v14.0)	complete
	GO:0016151	nickel ion binding	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0533	F	Seeded from EcoCyc (v14.0)	complete
	GO:0016151	nickel ion binding	PMID:19947632^[8]	IDA: Inferred from Direct Assay		F	Seeded from EcoCyc (v14.0)	complete
	GO:0016151	nickel ion binding	PMID:8300624^[7]	IDA: Inferred from Direct Assay		F	Seeded from EcoCyc (v14.0)	complete
	GO:0050897	cobalt ion binding	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0170	F	Seeded from EcoCyc (v14.0)	complete
	GO:0051082	unfolded protein binding	PMID:19356587^[9]	IDA: Inferred from Direct Assay		F	Seeded from EcoCyc (v14.0)	complete
	GO:0005515	protein binding	PMID:15569666^[10]	IPI: Inferred from Physical Interaction	UniProtKB:P0AAN3	F		complete
	GO:0051604	protein maturation	PMID:17426034^[11]	IMP: Inferred from Mutant Phenotype		P	Seeded from EcoCyc (v14.0)	complete
	GO:0022417	protein maturation by protein folding	PMID:15569666^[10]	IMP: Inferred from Mutant Phenotype		P		complete
	GO:0016151	nickel ion binding	PMID:19645725^[12]	IDA: Inferred from Direct Assay		F		complete
	GO:0009408	response to heat	PMID:17971396^[13]	IEP: Inferred from Expression Pattern		P		complete
	GO:0050821	protein stabilization	PMID:17971396^[13]	IMP: Inferred from Mutant Phenotype		P		complete
	GO:0003755	peptidyl-prolyl cis-trans isomerase activity	PMID:17720786^[14]	IMP: Inferred from Mutant Phenotype		F		complete
edit table

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type	Partner	Notes	References	Evidence
Protein	Subunits of FKBP-type peptidyl prolyl cis-trans isomerase	could be indirect
Protein	gltL		PMID:15690043^[15]	Experiment(s):EBI-893588
Protein	hupA		PMID:15690043^[15]	Experiment(s):EBI-893588
Protein	hupB		PMID:15690043^[15]	Experiment(s):EBI-893588
Protein	hypB		PMID:15690043^[15]	Experiment(s):EBI-893588
Protein	sapD		PMID:15690043^[15]	Experiment(s):EBI-893588
Protein	serS		PMID:15690043^[15]	Experiment(s):EBI-893588
Protein	ulaF		PMID:15690043^[15]	Experiment(s):EBI-893588
Protein	ydeI		PMID:15690043^[15]	Experiment(s):EBI-893588
Protein	nudL		PMID:15690043^[15]	Experiment(s):EBI-893588
Protein	grcA		PMID:15690043^[15]	Experiment(s):EBI-893588
Protein	yhjQ		PMID:15690043^[15]	Experiment(s):EBI-893588
Protein	ycgX		PMID:16606699^[16]	Experiment(s):EBI-1145639
Protein	rplE		PMID:16606699^[16]	Experiment(s):EBI-1145639
Protein	insA7		PMID:16606699^[16]	Experiment(s):EBI-1145639
Protein	betA		PMID:16606699^[16]	Experiment(s):EBI-1145639
Protein	rpmA		PMID:16606699^[16]	Experiment(s):EBI-1145639
Protein	rplW		PMID:16606699^[16]	Experiment(s):EBI-1145639
Protein	rplO		PMID:16606699^[16]	Experiment(s):EBI-1145639
Protein	rplF		PMID:16606699^[16]	Experiment(s):EBI-1145639
Protein	fliC		PMID:16606699^[16]	Experiment(s):EBI-1145639
Protein	rplN		PMID:16606699^[16]	Experiment(s):EBI-1145639
Protein	rpsI		PMID:16606699^[16]	Experiment(s):EBI-1145639
Protein	lacI		PMID:16606699^[16]	Experiment(s):EBI-1145639
Protein	rpsD		PMID:16606699^[16]	Experiment(s):EBI-1145639
Protein	yhdZ		PMID:16606699^[16]	Experiment(s):EBI-1145639
Protein	rpsE		PMID:16606699^[16]	Experiment(s):EBI-1145639
Protein	nusG		PMID:16606699^[16]	Experiment(s):EBI-1145639
Protein	yfiD		PMID:19402753^[17]	LCMS(ID Probability):99.0 MALDI(Z-score):3.263244
Protein	ampH		PMID:19402753^[17]	LCMS(ID Probability):99.6
Protein	HypB (GTPase & hydrogenase accessory protein)	HypB was shown to directly interact with SlyD & a slyD- strain has reduced hydrogenase activity & accumulates an immature (unprocessed) form of the hydrogenase (HycE), which can be complemented by the addition of nickel to the growth medium or complemented with plasmid-borne expression of SlyD. See PMID:15569666^[10]
edit table

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment	Description	Evidence	Reference/Source	Notes
edit table

Notes

Structure and Physical Properties

[back to top]

Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence	at EcoCyc MKVAKDLVVS LAYQVRTEDG VLVDESPVSA PLDYLHGHGS LISGLETALE GHEVGDKFDV AVGANDAYGQ YDENLVQRVP KDVFMGVDEL QVGMRFLAET DQGPVPVEIT AVEDDHVVVD GNHMLAGQNL KFNVEVVAIR EATEEELAHG HVHGAHDHHH DHDHDGCCGG HGHDHGHEHG GEGCCGGKGN GGCGCH
Length	196
Mol. Wt	20.85 kDa
pI	4.8 (calculated)
Extinction coefficient	5,960 - 6,710 (calc based on 4 Y, 0 W, and 6 C residues)
edit table

Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type	Residues	Description	Notes	References
Domain	1..137	PF00254 FKBP-type peptidyl-prolyl cis-trans isomerase		PMID:19920124^[18]
edit table

<motif_map/>

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=slyD taxon=562,83333 </beststructure>

Models

View models at:

edit table

Structure figures

Notes

Gene Product Resources

[back to top]

See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type	Source	Notes/Reference
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
NCBI (Protein) (EcoliWiki Page)	GI:16131228	Escherichia coli str. K-12 substr. MG1655
NCBI (Protein) (EcoliWiki Page)	GeneID:947859	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0010946	Escherichia coli str. K-12 substr. MG1655
UniProt (EcoliWiki Page)	UniProtKB/Swiss-Prot:P0A9K9	Escherichia coli str. K-12 substr. MG1655
EcoCyc	EcoCyc:EG11663	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG11663	Escherichia coli str. K-12 substr. MG1655
NCBI (Gene) (EcoliWiki Page)	GeneID:947859	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120001606	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB1614	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Expression

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Cellular Levels

[back to top]

See Help:Cellular levels

Molecule	Organism or Strain	Value	Units	Experimental Conditions	Assay used	Notes	Reference(s)
Protein	E. coli K-12 MC4100	5.85E+03	molecules/cell	Medium: median data from rich and minimal media Temperature (°C): 37 Doubling time (min): Growth Rate(min): Growth phase: other:	emPAI		PMID:18304323
Protein	Ecoli K-12	482.605+/-4.428	Molecules/cell	Medium: Temperature (°C): Doubling time (min): Growth Rate(min): * Growth phase: other: *		Single Molecule Fluorescence	PMID:20671182
mRNA	Ecoli K-12	0.23487+/-0.01604	Molecules/cell	Medium: Temperature (°C): Doubling time (min): Growth Rate(min): * Growth phase: other: *		by FISH	PMID:20671182
mRNA	Ecoli K-12	1.038135593	Molecules/cell	Medium: Temperature (°C): Doubling time (min): Growth Rate(min): * Growth phase: other: *		by RNA_Seq	PMID:20671182
Protein	E. coli K-12 MG1655	38169	molecules/cell/generation	Medium: MOPS Complete Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	7302	molecules/cell/generation	Medium: MOPS Minimal Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	20452	molecules/cell/generation	Medium: MOPS Complete without Methionine Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
edit table

Notes

Transcription and Transcriptional Regulation

[back to top]

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)
slyD
edit table

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]

<gbrowseImage> name=NC_000913:3476499..3476539 source=MG1655 flip=1 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]

Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name	Mutation	Phenotype	Reference
edit table

Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type	Reference	Notes
microarray	GEO Profiles:b3349 (EcoliWiki Page)	NCBI GEO profiles for slyD
microarray	GenExpDB:b3349 (EcoliWiki Page)	Summary of data for slyD from multiple microarray studies
edit table

Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name	Resource Type	Description	Source	Notes
	GFP Fusion	Intergenic region (3476053..3476465) fused to gfpmut2.	OpenBioSystems	GFP fusion described in Zaslaver, et al. Plate:109-AZ09; Well:B2^[19]
edit table

Notes

Accessions Related to slyD Expression

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG11663	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB1614	Escherichia coli str. K-12 substr. MG1655
EcoliGenExpDB (EcoliWiki Page)	EcoliGenExpDB:b3349
EcoGene	EcoGene:EG11663	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120001606	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0010946	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Evolution

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]

See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism	Homologs (Statistics)	Comments
Xenopus tropicalis	ENSXETP00000041168 (score: 1.000; bootstrap: 73%)	From Inparanoid:20070104
Shigella flexneri	SLYD	From SHIGELLACYC
E. coli O157	SLYD	From ECOO157CYC
edit table

Do-It-Yourself Web Tools

Notes

Families

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
Pfam (EcoliWiki Page)	PF00254 FKBP-type peptidyl-prolyl cis-trans isomerase
Superfamily (EcoliWiki Page)	SUPERFAMILY:54534
EcoCyc	EcoCyc:EG11663	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG11663	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120001606	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB1614	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0010946	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

References

[back to top]

See Help:References for how to manage references in EcoliWiki.

↑ ^1.00 ^1.01 ^1.02 ^1.03 ^1.04 ^1.05 ^1.06 ^1.07 ^1.08 ^1.09 ^1.10 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
↑ ^2.0 ^2.1 ^2.2 ^2.3 ^2.4 ^2.5 ^2.6 ^2.7 ^2.8 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^3.0 ^3.1 ^3.2 ^3.3 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^4.0 ^4.1 ^4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
↑ ^5.0 ^5.1 ^5.2 CGSC: The Coli Genetics Stock Center
↑ ^6.0 ^6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
↑ ^7.0 ^7.1 Wülfing, C et al. (1994) An Escherichia coli protein consisting of a domain homologous to FK506-binding proteins (FKBP) and a new metal binding motif. J. Biol. Chem. 269 2895-901 PubMed
↑ Kaluarachchi, H et al. (2009) The Ni(II)-binding properties of the metallochaperone SlyD. J. Am. Chem. Soc. 131 18489-500 PubMed
↑ Weininger, U et al. (2009) NMR solution structure of SlyD from Escherichia coli: spatial separation of prolyl isomerase and chaperone function. J. Mol. Biol. 387 295-305 PubMed
↑ ^10.0 ^10.1 ^10.2 Zhang, JW et al. (2005) A role for SlyD in the Escherichia coli hydrogenase biosynthetic pathway. J. Biol. Chem. 280 4360-6 PubMed
↑ Leach, MR et al. (2007) The role of complex formation between the Escherichia coli hydrogenase accessory factors HypB and SlyD. J. Biol. Chem. 282 16177-86 PubMed
↑ Martino, L et al. (2009) The interaction of the Escherichia coli protein SlyD with nickel ions illuminates the mechanism of regulation of its peptidyl-prolyl isomerase activity. FEBS J. 276 4529-44 PubMed
↑ ^13.0 ^13.1 Han, KY et al. (2007) Solubilization of aggregation-prone heterologous proteins by covalent fusion of stress-responsive Escherichia coli protein, SlyD. Protein Eng. Des. Sel. 20 543-9 PubMed
↑ Zhang, JW et al. (2007) The peptidyl-prolyl isomerase activity of SlyD is not required for maturation of Escherichia coli hydrogenase. J. Bacteriol. 189 7942-4 PubMed
↑ ^15.00 ^15.01 ^15.02 ^15.03 ^15.04 ^15.05 ^15.06 ^15.07 ^15.08 ^15.09 ^15.10 Butland, G et al. (2005) Interaction network containing conserved and essential protein complexes in Escherichia coli. Nature 433 531-7 PubMed
↑ ^16.00 ^16.01 ^16.02 ^16.03 ^16.04 ^16.05 ^16.06 ^16.07 ^16.08 ^16.09 ^16.10 ^16.11 ^16.12 ^16.13 ^16.14 ^16.15 Arifuzzaman, M et al. (2006) Large-scale identification of protein-protein interaction of Escherichia coli K-12. Genome Res. 16 686-91 PubMed
↑ ^17.0 ^17.1 Hu, P et al. (2009) Global functional atlas of Escherichia coli encompassing previously uncharacterized proteins. PLoS Biol. 7 e96 PubMed
↑ Finn, RD et al. (2010) The Pfam protein families database. Nucleic Acids Res. 38 D211-22 PubMed
↑ Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed

slyD:On One Page

Quickview

Notes

Gene

Nomenclature

Notes

Location(s) and DNA Sequence

Notes

Sequence Features

Notes

Alleles and Phenotypes

Notes

Genetic Interactions

Notes

Genetic Resources

Notes

Accessions in Other Databases

Notes

Links

Product(s)

Nomenclature

Notes

Function

Notes

Localization

Notes

Structure and Physical Properties

Structure figures

Notes

Gene Product Resources

Notes

Accessions in Other Databases

Notes

Links

Expression

Overview

Cellular Levels

Notes

Transcription and Transcriptional Regulation

Notes

Translation and Regulation of Translation

Notes

Turnover and Regulation of Turnover

Notes

Experimental

Notes

Accessions Related to slyD Expression

Notes

Links

Evolution

Homologs in Other Organisms

Do-It-Yourself Web Tools

Notes

Families

Notes

Links

References

Categories

Navigation menu

Search