sfsB:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
| Standard Name |
sfsB |
|---|---|
| Gene Synonym(s) |
ECK3177, b3188, JW3155, nlp, sfs7[1], sfs7 |
| Product Desc. |
Nlp transcriptional regulator[2][3] Overexpression increases maltose and lactose utilization; stimulates MalQ, MalP and LacZ[4] |
| Product Synonyms(s) |
DNA-binding transcriptional activator of maltose metabolism[1], B3188[2][1], SfsB[2][1], Nlp[2][1] , ECK3177, JW3155, nlp, sfs7, b3188 |
| Function from GO |
<GO_nr /> |
| Knock-Out Phenotype | |
| Regulation/Expression | |
| Regulation/Activity | |
| Quick Links | |
| edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
SfsB is homologous to the Ner regulatory protein of phage Mu.[4]
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
sfsB |
|---|---|
| Mnemonic |
Sugar fermentation stimulation |
| Synonyms |
ECK3177, b3188, JW3155, nlp, sfs7[1], sfs7 |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
71.84 minutes |
MG1655: 3332931..3333209 |
||
|
NC_012967: 3270144..3270422 |
||||
|
NC_012759: 3220079..3220357 |
||||
|
W3110 |
|
W3110: 3334764..3335042 |
||
|
DH10B: 3430676..3430954 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔsfsB (Keio:JW3155) |
deletion |
deletion |
PMID:16738554 |
||||
|
sfsB203::Tn10 |
Insertion at 3,333,181 bp in MG1655 (NC_000913) |
adapted from Nichols et al.[6] |
Synonyms: zgj-203::Tn10, zha-203::Tn10 | ||||
|
sfsB3198::Tn10kan |
PMID:2540407 PMID:9829956 |
||||||
|
sfsB203::Tn10 |
PMID:2540407 PMID:9829956 |
||||||
|
ΔsfsB720::kan |
PMID:16738554 |
| |||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW3155 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCGAAAGTAATTTCATTGACTG Primer 2:CCTTTTTTCGGTTTAGTGTAGCT | |
|
Kohara Phage |
PMID:3038334 | ||
|
Linked marker |
est. P1 cotransduction: % [6] | ||
|
Linked marker |
est. P1 cotransduction: 30% [6] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG10656 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10656 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120000649 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EchoBASE:EB0650 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0010477 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
| Standard name |
SfsB |
|---|---|
| Synonyms |
DNA-binding transcriptional activator of maltose metabolism[1], B3188[2][1], SfsB[2][1], Nlp[2][1] , ECK3177, JW3155, nlp, sfs7, b3188 |
| Product description |
Nlp transcriptional regulator[2][3] Overexpression increases maltose and lactose utilization; stimulates MalQ, MalP and LacZ[4] |
| EC number (for enzymes) |
|
| edit table |
<protect></protect>
Notes
The sfsB gene was originally named nlp for Ner-like protein based on its amino acid sequence similarity to the DNA-binding domain of the Ner repressor from phage Mu. SfsB belongs to the family of Lambda repressor-like, DNA-binding proteins (IPR010982) so is likely to be a transcription factor. However, it's physiological role is not clear.
When present in multicopy, sfsB allows strain MK2001 to ferment maltose[7]. MK2001 is an E. coli K-12 strain that doesn't make cAMP because the cya gene is disrupted by insertion of a KmR cassette and that also carries the crp*1 mutation. The crp*1 allele allows a strain lacking cAMP to have a Lac+ phenotype on MacConkey lactose medium, but is still Mal- on MacConkey maltose medium [8]. The sfsB gene in multicopy does not confer a Mal+ on a cya::KmR crp+ strain.
A total of 12 different E. coli DNA fragments with this phenotype were isolated [9]. One other of the plasmid inserts, sfs1, was sequenced. The sfs1 gene was later renamed sfsA. Whether sfsA and sfsB are normally involved in regulating maltose catabolism has not been determined.
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
| Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
|---|---|---|---|---|---|---|---|---|
| edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
| Partner Type | Partner | Notes | References | Evidence |
|---|---|---|---|---|
|
Protein |
rpsD |
PMID:16606699 |
Experiment(s):EBI-1145105 | |
|
Protein |
ybaA |
PMID:16606699 |
Experiment(s):EBI-1145105 | |
|
Protein |
yneG |
PMID:16606699 |
Experiment(s):EBI-1145105 | |
|
Protein |
rplB |
PMID:16606699 |
Experiment(s):EBI-1145105 | |
|
Protein |
yghW |
PMID:16606699 |
Experiment(s):EBI-1145105 | |
| edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
| Compartment | Description | Evidence | Reference/Source | Notes |
|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
| Name | |
|---|---|
| Sequence |
MESNFIDWHP ADIIAGLRKK GTSMAAESRR NGLSSSTLAN ALSRPWPKGE MIIAKALGTD PWVIWPSRYH DPQTHEFIDR TQLMRSYTKP KK |
| Length |
92 |
| Mol. Wt |
10.495 kDa |
| pI |
10.3 (calculated) |
| Extinction coefficient |
24,980 (calc based on 2 Y, 4 W, and 0 C residues) |
| edit table |
Domains/Motifs/Modification Sites
|
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
|
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
| Resource type | Source | Notes/Reference |
|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
ASAP:ABE-0010477 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EcoCyc:EG10656 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10656 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
RegulonDB:ECK120000649 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB0650 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
| Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
|---|---|---|---|---|---|---|---|
|
Protein |
E. coli K-12 MG1655 |
171 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
43 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
71a |
molecules/cell/generation |
|
Ribosome Profiling |
Low confidence in the sequencing data set. |
PMID: 24766808 |
| edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
|
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
Figure courtesy of RegulonDB |
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:3332911..3332951
source=MG1655
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
| Allele Name | Mutation | Phenotype | Reference |
|---|---|---|---|
| edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
| Type | Reference | Notes |
|---|---|---|
|
microarray |
NCBI GEO profiles for sfsB | |
|
microarray |
Summary of data for sfsB from multiple microarray studies | |
| edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
| Resource Name | Resource Type | Description | Source | Notes |
|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions Related to sfsB Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG10656 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB0650 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10656 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120000649 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0010477 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
| Organism | Homologs (Statistics) | Comments |
|---|---|---|
|
Shigella flexneri |
NLP |
From SHIGELLACYC |
|
E. coli O157 |
NLP |
From ECOO157CYC |
| edit table |
<protect></protect>
Notes
Families
<protect>
See Help:Evolution_families for help entering or editing information in this section of EcoliWiki.
| Database | Accession | Notes |
|---|---|---|
| edit table |
</protect> <protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8 1.9 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 2.2 2.3 2.4 2.5 2.6 2.7 2.8 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 5.0 5.1 5.2 5.3 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 6.2 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ Choi, YL et al. (1989) Cloning and sequencing of an Escherichia coli gene, nlp, highly homologous to the ner genes of bacteriophages Mu and D108. J. Bacteriol. 171 5222-5 PubMed
- ↑ Aiba, H et al. (1985) Mutations that alter the allosteric nature of cAMP receptor protein of Escherichia coli. EMBO J. 4 3329-32 PubMed
- ↑ Kawamukai, M et al. (1991) Nucleotide sequence and characterization of the sfs1 gene: sfs1 is involved in CRP*-dependent mal gene expression in Escherichia coli. J. Bacteriol. 173 2644-8 PubMed
Categories


