sdiA:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Standard Name |
sdiA |
---|---|
Gene Synonym(s) |
ECK1915, b1916, JW1901, uvrX[1], uvrX |
Product Desc. |
SdiA transcriptional activator[2]; SdiA transcriptional dual regulator[3] Quorum-sensing ftsQAZ-P2, acrABCDE transcriptional activator; fluoroquinolone resistance; overproduction confers drug resistance by stimulating the acr genes; SdiA senses exogenous N-acyl homoserine lactones[4] |
Product Synonyms(s) |
DNA-binding transcriptional activator[1], B1916[2][1], SdiA[2][1] , ECK1915, JW1901, uvrX, b1916 |
Function from GO |
<GO_nr /> |
Knock-Out Phenotype | |
Regulation/Expression | |
Regulation/Activity | |
Quick Links | |
edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
Suppresses inhibitory effect of the MinC/MinD division inhibitor. N-acyl homoserine lactones act as folding switches for SdiA. LuxR family. SdiA has other global transcription targets such as uvrY, csrB, recN and nei. E. coli makes an unknown weak auto-inducer when grown in rich media. Most phenotypic effects require overproduction of SdiA. sdiA mutants are more sensitive to fluoroquinolones and have reduced AcrB protein, but are not defective in cell division. An sdiA ydiV double mutant has twofold reduced cAMP levels than inhibits quorum sensing system 2 (Zhou, 2008).[4]
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Standard name |
sdiA |
---|---|
Mnemonic |
Suppress division inhibitors |
Synonyms |
ECK1915, b1916, JW1901, uvrX[1], uvrX |
edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
---|---|---|---|---|
MG1655 |
42.98 minutes |
MG1655: 1994856..1994134 |
||
NC_012759: 1886617..1887339 |
||||
W3110 |
|
W3110: 1998969..1998247 |
||
DH10B: 2085864..2085142 |
||||
edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
---|---|---|---|---|---|
edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
---|---|---|---|---|---|---|---|
sdiA(del) (Keio:JW1901) |
deletion |
deletion |
PMID:16738554 |
||||
sdiA(del)::kan |
deletion |
Biolog:respiration |
unable to respire Acetate |
PMID:16095938 |
|||
sdiA(del)::kan |
deletion |
Biolog:respiration |
unable to respire Bromosuccinate |
PMID:16095938 |
|||
sdiA(del)::kan |
deletion |
Biolog:respiration |
unable to respire L-Asparagine |
PMID:16095938 |
|||
sdiA(del)::kan |
deletion |
Biolog:respiration |
unable to respire L-Aspartate |
PMID:16095938 |
|||
sdiA762(del)::kan |
PMID:16738554 |
||||||
sdiA1E11 |
truncation at C-terminus |
Growth Phenotype |
biofilm formation is reduced from wild type due to increased indole concentration, 2A 2B. |
PMID:19168658 |
| ||
edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
---|---|---|---|---|---|---|
edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
Resource | Resource Type | Source | Notes/Reference |
---|---|---|---|
JW1901 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCCAGGATAAGGATTTTTTCAG Primer 2:CCAATTAAGCCAGTAGCGGCCGC | |
Kohara Phage |
PMID:3038334 | ||
Linked marker |
est. P1 cotransduction: 88% [6] | ||
Linked marker |
est. P1 cotransduction: 16% [6] | ||
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG10935 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10935 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120000924 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EchoBASE:EB0928 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0006381 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
Standard name |
SdiA |
---|---|
Synonyms |
DNA-binding transcriptional activator[1], B1916[2][1], SdiA[2][1] , ECK1915, JW1901, uvrX, b1916 |
Product description |
SdiA transcriptional activator[2]; SdiA transcriptional dual regulator[3] Quorum-sensing ftsQAZ-P2, acrABCDE transcriptional activator; fluoroquinolone resistance; overproduction confers drug resistance by stimulating the acr genes; SdiA senses exogenous N-acyl homoserine lactones[4] |
EC number (for enzymes) |
|
edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
---|---|---|---|---|---|---|---|---|
GO:0000156 |
two-component response regulator activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR016032 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0000160 |
two-component signal transduction system (phosphorelay) |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR016032 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0003677 |
DNA binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR016032 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0003677 |
DNA binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0238 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0003700 |
transcription factor activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000792 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005622 |
intracellular |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000792 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005622 |
intracellular |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR016032 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006350 |
transcription |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0804 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006355 |
regulation of transcription, DNA-dependent |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000792 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006355 |
regulation of transcription, DNA-dependent |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR016032 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0007049 |
cell cycle |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0131 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0043565 |
sequence-specific DNA binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000792 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0051301 |
cell division |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0132 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
Partner Type | Partner | Notes | References | Evidence |
---|---|---|---|---|
Protein |
glvG |
PMID:16606699 |
Experiment(s):EBI-1141330 | |
Protein |
groL |
PMID:16606699 |
Experiment(s):EBI-1141330 | |
Protein |
rplD |
PMID:16606699 |
Experiment(s):EBI-1141330 | |
Protein |
dnaK |
PMID:16606699 |
Experiment(s):EBI-1141330 | |
edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
Compartment | Description | Evidence | Reference/Source | Notes |
---|---|---|---|---|
edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
Name | |
---|---|
Sequence |
MQDKDFFSWR RTMLLRFQRM ETAEEVYHEI ELQAQQLEYD YYSLCVRHPV PFTRPKVAFY TNYPEAWVSY YQAKNFLAID PVLNPENFSQ GHLMWNDDLF SEAQPLWEAA RAHGLRRGVT QYLMLPNRAL GFLSFSRCSA REIPILSDEL QLKMQLLVRE SLMALMRLND EIVMTPEMNF SKREKEILRW TAEGKTSAEI AMILSISENT VNFHQKNMQK KINAPNKTQV ACYAAATGLI |
Length |
240 |
Mol. Wt |
28.117 kDa |
pI |
7.0 (calculated) |
Extinction coefficient |
42,400 - 42,775 (calc based on 10 Y, 5 W, and 3 C residues) |
edit table |
Domains/Motifs/Modification Sites
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
Resource type | Source | Notes/Reference |
---|---|---|
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
ASAP:ABE-0006381 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EcoCyc:EG10935 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10935 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
RegulonDB:ECK120000924 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB0928 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
---|---|---|---|---|---|---|---|
Protein |
Ecoli K-12 |
11.684+/-0.134 |
Molecules/cell |
|
Single Molecule Fluorescence |
PMID:20671182 | |
mRNA |
Ecoli K-12 |
0.023545706 |
Molecules/cell |
|
by RNA_Seq |
PMID:20671182 | |
Protein |
E. coli K-12 MG1655 |
434 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
87 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
563 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:1994836..1994876
source=MG1655
flip=1
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
Allele Name | Mutation | Phenotype | Reference |
---|---|---|---|
edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
Type | Reference | Notes |
---|---|---|
microarray |
NCBI GEO profiles for sdiA | |
microarray |
Summary of data for sdiA from multiple microarray studies | |
edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
Resource Name | Resource Type | Description | Source | Notes |
---|---|---|---|---|
edit table |
<protect></protect>
Notes
Accessions Related to sdiA Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG10935 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB0928 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10935 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120000924 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0006381 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
Organism | Homologs (Statistics) | Comments |
---|---|---|
Shigella flexneri |
SDIA |
From SHIGELLACYC |
E. coli O157 |
SDIA |
From ECOO157CYC |
edit table |
Do-It-Yourself Web Tools
<protect></protect>
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG10935 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10935 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120000924 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB0928 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0006381 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 2.2 2.3 2.4 2.5 2.6 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
Categories