{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

On One Page

Quickview |

Gene |

Product(s) |

Expression|

Evolution |

References |

Quickview

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Standard Name	sdhD
Gene Synonym(s)	ECK0711, b0722, JW0712, dhsD, cybS^[1]^[2]
Product Desc.	succinate dehydrogenase membrane protein^[2]^[3]; Component of membrane-bound subcomplex of succinate dehydrogenase^[3]; succinate dehydrogenase^[3] Succinate dehydrogenase (SQR) hydrophobic subunit; succinate:ubiquinone oxidoreductase (SQR); complex II of aerobic respiration^[4]
Product Synonyms(s)	succinate dehydrogenase, membrane subunit, binds cytochrome b556^[1], B0722^[2]^[1], DhsD^[2]^[1], SdhD^[2]^[1], CybS^[2]^[1], small subunit of cytochrome b₅₅₆^[2]^[1] , ECK0711, JW0712, b0722
Function from GO	<GO_nr />
Knock-Out Phenotype
Regulation/Expression	transcription unit(s): sdhDAB^[2], sdhCDAB-sucABCD^[2], OP00142, sdhCDAB
Regulation/Activity
Quick Links
edit table

</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>

Notes

[back to top]

The sdhABCD operon is negatively regulated by ryhB RNA as part of indirect positive regulation by Fur.^[4]

Gene

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css> <protect>

Nomenclature

[back to top]

See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name	sdhD
Mnemonic	Succinate dehydrogenase
Synonyms	ECK0711, b0722, JW0712, dhsD, cybS^[1]^[2]
edit table

</protect>

Notes

Location(s) and DNA Sequence

[back to top]

<protect> See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain	Map location	Genome coordinates	Genome browsers	Sequence links
MG1655	16.27 minutes	MG1655: 754783..755130 <gbrowseImage> name=NC_000913:754783..755130 source=MG1655 preset=GeneLocation </gbrowseImage>	EcoCyc GBrowse(MG1655)	FASTA Dump EcoCyc Sequence Dump
REL606		NC_012967: 736351..736698 <gbrowseImage> name=NC_012967:736351..736698 source=REL606 preset=GeneLocation </gbrowseImage>	GBrowse (REL606)	FASTA Dump
BW2952		NC_012759: 657543..657890 <gbrowseImage> name=NC_012759:657543..657890 source=BW2952 preset=GeneLocation </gbrowseImage>	GBrowse (BW2952)	FASTA Dump
W3110		W3110: 755982..756329 <gbrowseImage> name=NC_007779:755982..756329 source=W3110 preset=GeneLocation </gbrowseImage>	GBrowse(W3110)	FASTA Dump
DH10B		DH10B: 807375..807722 <gbrowseImage> name=NC_010473:807375..807722 source=DH10B preset=GeneLocation </gbrowseImage>	GBrowse(DH10B)	FASTA Dump
edit table

</protect>

Notes

Sequence Features

[back to top]

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type	Strain	Genomic Location	Evidence	Reference	Notes
edit table

Notes

Alleles and Phenotypes

[back to top]

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele	Nt change(s)	AA change(s)	Phenotype: Type	Phenotype: Description	Reference	Availability	Comments
sdhD(del) (Keio:JW0712)	deletion	deletion			PMID:16738554	Shigen CGSC8785^[5]
sdhD::Tn5KAN-2 (FB20223)	Insertion at nt 203 in Plus orientation				PMID:15262929	E. coli Genome Project:FB20223	does not contain pKD46
sdhD(del)::kan	deletion		Biolog:respiration	unable to respire b-Methyl-D-glucoside	PMID:16095938
sdhD(del)::kan	deletion		Biolog:respiration	unable to respire DL-a-Glycerol	PMID:16095938
sdhD(del)::kan	deletion		Biolog:respiration	unable to respire Acetate	PMID:16095938
sdhD(del)::kan	deletion		Biolog:respiration	unable to respire a-Hydroxybutyrate	PMID:16095938
sdhD(del)::kan	deletion		Biolog:respiration	unable to respire a-Ketobutyrate	PMID:16095938
sdhD(del)::kan	deletion		Biolog:respiration	unable to respire a-Ketoglutarate	PMID:16095938
sdhD(del)::kan	deletion		Biolog:respiration	unable to respire Succinate	PMID:16095938
sdhD(del)::kan	deletion		Biolog:respiration	unable to respire Bromosuccinate	PMID:16095938
sdhD(del)::kan	deletion		Biolog:respiration	unable to respire L-Alanine	PMID:16095938
sdhD(del)::kan	deletion		Biolog:respiration	unable to respire L-Alanyl-glycine	PMID:16095938
sdhD(del)::kan	deletion		Biolog:respiration	unable to respire L-Asparagine	PMID:16095938
sdhD(del)::kan	deletion		Biolog:respiration	unable to respire L-Aspartate	PMID:16095938
sdhD(del)::kan	deletion		Biolog:respiration	unable to respire L-Serine	PMID:16095938
sdhD772(del)::kan					PMID:16738554	CGSC:102898
sdhD(del)::kan	deletion		Biolog:respiration	unable to respire D-Galacturonate	PMID:16095938
CAG45114 sdhD772(del)::FRTKanFRT	Deletion		Sigma^E activity	Decrease in Sigma^E activity	PMID:23224554	Parental Strain: CAG45114 Experimental Strain: SMR15267	See table S11 for full experimental results.
SMR4562 yiaG-yfp FRTcatFRT sdhD772::FRTKanFRT	deletion		Sigma^S activity	Decrease in Sigma^S activity	PMID:23224554	Parental Strain: SMR10582 Experimental Strain: SMR13033	See table S8 for full experimental data
edit table

Notes

Genetic Interactions

[back to top]

Interactor	Interaction	Allele	Score(s)	Reference(s)	Accessions	Notes
edit table

</protect>

Notes

Genetic Resources

[back to top]

See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource	Resource Type	Source	Notes/Reference
JW0712	Plasmid clone	Shigen	PMID:16769691 Status:Clone OK Primer 1:GCCGTAAGCAACGCCTCCGCATT Primer 2:CCCACACCCCACACCACAACGAA
7E10	Kohara Phage	Genobase	PMID:3038334
asnB3057::Tn10	Linked marker	CAG18433 = CGSC7349^[5]	est. P1 cotransduction: 7% ^[6] Synonyms:zbf-3057::Tn10 nnnThe Tn10 in CAG18433 is inserted in the asnB regulatory region, 4 bp before the start of the asnB ORF.
nadA57::Tn10	Linked marker	CAG12147 = CGSC7351^[5]	est. P1 cotransduction: 40% ^[6]
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG10934	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10934	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000923	Escherichia coli str. K-12 substr. MG1655
NCBI (EcoliWiki Page)	GeneID:945322	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0927	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0002464	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Product(s)

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name	SdhD
Synonyms	succinate dehydrogenase, membrane subunit, binds cytochrome b556^[1], B0722^[2]^[1], DhsD^[2]^[1], SdhD^[2]^[1], CybS^[2]^[1], small subunit of cytochrome b₅₅₆^[2]^[1] , ECK0711, JW0712, b0722
Product description	succinate dehydrogenase membrane protein^[2]^[3]; Component of membrane-bound subcomplex of succinate dehydrogenase^[3]; succinate dehydrogenase^[3] Succinate dehydrogenase (SQR) hydrophobic subunit; succinate:ubiquinone oxidoreductase (SQR); complex II of aerobic respiration^[4]
EC number (for enzymes)
edit table

Notes

Function

[back to top]

<protect> Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier	GO ID	GO term name	Reference	Evidence Code	with/from	Aspect	Notes	Status
	GO:0000104	succinate dehydrogenase activity	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR000701	F	Seeded from EcoCyc (v14.0)	complete
	GO:0005886	plasma membrane	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0997	C	Seeded from EcoCyc (v14.0)	complete
	GO:0005886	plasma membrane	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-1003	C	Seeded from EcoCyc (v14.0)	complete
	GO:0006099	tricarboxylic acid cycle	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR000701	P	Seeded from EcoCyc (v14.0)	complete
	GO:0000104	succinate dehydrogenase activity				F		Missing: evidence, reference
	GO:0006099	tricarboxylic acid cycle	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0816	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006810	transport	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0813	P	Seeded from EcoCyc (v14.0)	complete
	GO:0009055	electron carrier activity	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR000701	F	Seeded from EcoCyc (v14.0)	complete
	GO:0009055	electron carrier activity	PMID:12788489	IDA: Inferred from Direct Assay		F	Seeded from EcoCyc (v14.0)	complete
	GO:0009060	aerobic respiration	PMID:7783618	IEP: Inferred from Expression Pattern		P	Seeded from EcoCyc (v14.0)	complete
	GO:0016020	membrane	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR000701	C	Seeded from EcoCyc (v14.0)	complete
	GO:0016020	membrane	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0472	C	Seeded from EcoCyc (v14.0)	complete
	GO:0016021	integral to membrane	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0812	C	Seeded from EcoCyc (v14.0)	complete
	GO:0016021	integral to membrane	GO_REF:0000023	IEA: Inferred from Electronic Annotation	SP_SL:SL-9909	C	Seeded from EcoCyc (v14.0)	complete
	GO:0017004	cytochrome complex assembly	PMID:9521736	IMP: Inferred from Mutant Phenotype		P	Seeded from EcoCyc (v14.0)	complete
	GO:0020037	heme binding	PMID:9521736	IMP: Inferred from Mutant Phenotype		F	Seeded from EcoCyc (v14.0)	complete
	GO:0022900	electron transport chain	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0249	P	Seeded from EcoCyc (v14.0)	complete
edit table

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type	Partner	Notes
Protein	Subunits of membrane-bound subcomplex of succinate dehydrogenase	could be indirect
Protein	Subunits of succinate dehydrogenase	could be indirect
edit table

</protect>

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment	Description	Evidence	Reference/Source
plasma membrane	C-terminus localized to the periplasm with 3 predicted transmembrane domains	Daley et al. (2005) ^[7]
plasma membrane			From EcoCyc^[3]
edit table

Notes

Structure and Physical Properties

[back to top]

<protect> Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence	at EcoCyc MVSNASALGR NGVHDFILVR ATAIVLTLYI IYMVGFFATS GELTYEVWIG FFASAFTKVF TLLALFSILI HAWIGMWQVL TDYVKPLALR LMLQLVIVVA LVVYVIYGFV VVWGV
Length	115
Mol. Wt	12.867 kDa
pI	7.9 (calculated)
Extinction coefficient	30,940 (calc based on 6 Y, 4 W, and 0 C residues)
edit table

Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type	Residues	Description	Notes	References
Domain	2..113	PF01127 Succinate dehydrogenase/Fumarate reductase transmembrane subunit		PMID:19920124
edit table

<motif_map/>

Click the image to view raw output from TMHMM.

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=sdhD taxon=562,83333 </beststructure>

Models

View models at:

edit table

</protect>

Structure figures

</protect>

Notes

Gene Product Resources

[back to top]

See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type	Source	Notes/Reference
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
NCBI (Protein) (EcoliWiki Page)	GI:16128697	Escherichia coli str. K-12 substr. MG1655
NCBI (Protein) (EcoliWiki Page)	GeneID:945322	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0002464	Escherichia coli str. K-12 substr. MG1655
UniProt (EcoliWiki Page)	UniProtKB/Swiss-Prot:P0AC44	Escherichia coli str. K-12 substr. MG1655
EcoCyc	EcoCyc:EG10934	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10934	Escherichia coli str. K-12 substr. MG1655
NCBI (Gene) (EcoliWiki Page)	GeneID:945322	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000923	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0927	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Expression

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Cellular Levels

[back to top]

See Help:Cellular levels

Molecule	Organism or Strain	Value	Units	Experimental Conditions	Assay used	Reference(s)
Protein	E. coli K-12 MG1655	2341	molecules/cell/generation	Medium: MOPS Complete Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	PMID: 24766808
Protein	E. coli K-12 MG1655	2508	molecules/cell/generation	Medium: MOPS Minimal Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	PMID: 24766808
Protein	E. coli K-12 MG1655	1273	molecules/cell/generation	Medium: MOPS Complete without Methionine Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	PMID: 24766808
edit table

Notes

Transcription and Transcriptional Regulation

[back to top]

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)
sdhDAB
sdhCDAB-sucABCD
edit table

Figure courtesy of RegulonDB

</protect>

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]

<protect><gbrowseImage> name=NC_000913:754763..754803 source=MG1655 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

</protect>

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]

<protect> Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name	Mutation	Phenotype	Reference
edit table

Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type	Reference	Notes
microarray	GEO Profiles:b0722 (EcoliWiki Page)	NCBI GEO profiles for sdhD
microarray	GenExpDB:b0722 (EcoliWiki Page)	Summary of data for sdhD from multiple microarray studies
edit table

Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name	Resource Type	Description	Source	Notes
edit table

Notes

Accessions Related to sdhD Expression

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG10934	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0927	Escherichia coli str. K-12 substr. MG1655
EcoliGenExpDB (EcoliWiki Page)	EcoliGenExpDB:b0722
EcoGene	EcoGene:EG10934	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000923	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0002464	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Evolution

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]

See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism	Homologs (Statistics)	Comments
Shigella flexneri	SDHD	From SHIGELLACYC
E. coli O157	SDHD	From ECOO157CYC
edit table

Notes

Families

[back to top]

<protect> See Help:Evolution_families for help entering or editing information in this section of EcoliWiki.

Database	Accession	Notes
Pfam (EcoliWiki Page)	PF01127 Succinate dehydrogenase/Fumarate reductase transmembrane subunit
edit table

</protect> <protect></protect>

Notes

Links

[back to top]

Name	URL	Comments
edit table

References

[back to top]

See Help:References for how to manage references in EcoliWiki.

↑ ^1.00 ^1.01 ^1.02 ^1.03 ^1.04 ^1.05 ^1.06 ^1.07 ^1.08 ^1.09 ^1.10 ^1.11 ^1.12 ^1.13 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
↑ ^2.00 ^2.01 ^2.02 ^2.03 ^2.04 ^2.05 ^2.06 ^2.07 ^2.08 ^2.09 ^2.10 ^2.11 ^2.12 ^2.13 ^2.14 ^2.15 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^3.0 ^3.1 ^3.2 ^3.3 ^3.4 ^3.5 ^3.6 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^4.0 ^4.1 ^4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
↑ ^5.0 ^5.1 ^5.2 CGSC: The Coli Genetics Stock Center
↑ ^6.0 ^6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
↑ Daley, DO et al. (2005) Global topology analysis of the Escherichia coli inner membrane proteome. Science 308 1321-3 PubMed

sdhD:On One Page

Quickview

Notes

Gene

Nomenclature

Notes

Location(s) and DNA Sequence

Notes

Sequence Features

Notes

Alleles and Phenotypes

Notes

Genetic Interactions

Notes

Genetic Resources

Notes

Accessions in Other Databases

Notes

Links

Product(s)

Nomenclature

Notes

Function

Notes

Localization

Notes

Structure and Physical Properties

Structure figures

Notes

Gene Product Resources

Notes

Accessions in Other Databases

Notes

Links

Expression

Overview

Cellular Levels

Notes

Transcription and Transcriptional Regulation

Notes

Translation and Regulation of Translation

Notes

Turnover and Regulation of Turnover

Notes

Experimental

Notes

Accessions Related to sdhD Expression

Notes

Links

Evolution

Homologs in Other Organisms

Notes

Families

Notes

Links

References

Categories

Navigation menu

Search