sdhD:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Standard Name |
sdhD |
---|---|
Gene Synonym(s) | |
Product Desc. |
succinate dehydrogenase membrane protein[2][3]; Component of membrane-bound subcomplex of succinate dehydrogenase[3]; succinate dehydrogenase[3] Succinate dehydrogenase (SQR) hydrophobic subunit; succinate:ubiquinone oxidoreductase (SQR); complex II of aerobic respiration[4] |
Product Synonyms(s) |
succinate dehydrogenase, membrane subunit, binds cytochrome b556[1], B0722[2][1], DhsD[2][1], SdhD[2][1], CybS[2][1], small subunit of cytochrome b556[2][1] , ECK0711, JW0712, b0722 |
Function from GO |
<GO_nr /> |
Knock-Out Phenotype | |
Regulation/Expression |
transcription unit(s): sdhDAB[2], sdhCDAB-sucABCD[2], OP00142, sdhCDAB |
Regulation/Activity | |
Quick Links | |
edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
The sdhABCD operon is negatively regulated by ryhB RNA as part of indirect positive regulation by Fur.[4]
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Standard name |
sdhD |
---|---|
Mnemonic |
Succinate dehydrogenase |
Synonyms | |
edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
---|---|---|---|---|
MG1655 |
16.27 minutes |
MG1655: 754783..755130 |
||
NC_012967: 736351..736698 |
||||
NC_012759: 657543..657890 |
||||
W3110 |
|
W3110: 755982..756329 |
||
DH10B: 807375..807722 |
||||
edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
---|---|---|---|---|---|
edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
---|---|---|---|---|---|---|---|
sdhD(del) (Keio:JW0712) |
deletion |
deletion |
PMID:16738554 |
||||
sdhD::Tn5KAN-2 (FB20223) |
Insertion at nt 203 in Plus orientation |
PMID:15262929 |
does not contain pKD46 | ||||
sdhD(del)::kan |
deletion |
Biolog:respiration |
unable to respire b-Methyl-D-glucoside |
PMID:16095938 |
|||
sdhD(del)::kan |
deletion |
Biolog:respiration |
unable to respire DL-a-Glycerol |
PMID:16095938 |
|||
sdhD(del)::kan |
deletion |
Biolog:respiration |
unable to respire Acetate |
PMID:16095938 |
|||
sdhD(del)::kan |
deletion |
Biolog:respiration |
unable to respire a-Hydroxybutyrate |
PMID:16095938 |
|||
sdhD(del)::kan |
deletion |
Biolog:respiration |
unable to respire a-Ketobutyrate |
PMID:16095938 |
|||
sdhD(del)::kan |
deletion |
Biolog:respiration |
unable to respire a-Ketoglutarate |
PMID:16095938 |
|||
sdhD(del)::kan |
deletion |
Biolog:respiration |
unable to respire Succinate |
PMID:16095938 |
|||
sdhD(del)::kan |
deletion |
Biolog:respiration |
unable to respire Bromosuccinate |
PMID:16095938 |
|||
sdhD(del)::kan |
deletion |
Biolog:respiration |
unable to respire L-Alanine |
PMID:16095938 |
|||
sdhD(del)::kan |
deletion |
Biolog:respiration |
unable to respire L-Alanyl-glycine |
PMID:16095938 |
|||
sdhD(del)::kan |
deletion |
Biolog:respiration |
unable to respire L-Asparagine |
PMID:16095938 |
|||
sdhD(del)::kan |
deletion |
Biolog:respiration |
unable to respire L-Aspartate |
PMID:16095938 |
|||
sdhD(del)::kan |
deletion |
Biolog:respiration |
unable to respire L-Serine |
PMID:16095938 |
|||
sdhD772(del)::kan |
PMID:16738554 |
||||||
sdhD(del)::kan |
deletion |
Biolog:respiration |
unable to respire D-Galacturonate |
PMID:16095938 |
|||
CAG45114 sdhD772(del)::FRTKanFRT |
Deletion |
SigmaE activity |
Decrease in SigmaE activity |
PMID:23224554 |
Parental Strain: CAG45114 Experimental Strain: SMR15267 |
See table S11 for full experimental results. | |
SMR4562 yiaG-yfp FRTcatFRT sdhD772::FRTKanFRT |
deletion |
SigmaS activity |
Decrease in SigmaS activity |
PMID:23224554 |
Parental Strain: SMR10582 Experimental Strain: SMR13033 |
See table S8 for full experimental data | |
edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
---|---|---|---|---|---|---|
edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
Resource | Resource Type | Source | Notes/Reference |
---|---|---|---|
JW0712 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCGTAAGCAACGCCTCCGCATT Primer 2:CCCACACCCCACACCACAACGAA | |
Kohara Phage |
PMID:3038334 | ||
Linked marker |
est. P1 cotransduction: 7% [6] | ||
Linked marker |
est. P1 cotransduction: 40% [6] | ||
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG10934 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10934 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120000923 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EchoBASE:EB0927 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0002464 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
Standard name |
SdhD |
---|---|
Synonyms |
succinate dehydrogenase, membrane subunit, binds cytochrome b556[1], B0722[2][1], DhsD[2][1], SdhD[2][1], CybS[2][1], small subunit of cytochrome b556[2][1] , ECK0711, JW0712, b0722 |
Product description |
succinate dehydrogenase membrane protein[2][3]; Component of membrane-bound subcomplex of succinate dehydrogenase[3]; succinate dehydrogenase[3] Succinate dehydrogenase (SQR) hydrophobic subunit; succinate:ubiquinone oxidoreductase (SQR); complex II of aerobic respiration[4] |
EC number (for enzymes) |
|
edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
---|---|---|---|---|---|---|---|---|
GO:0000104 |
succinate dehydrogenase activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000701 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005886 |
plasma membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0997 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005886 |
plasma membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-1003 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006099 |
tricarboxylic acid cycle |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000701 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0000104 |
succinate dehydrogenase activity |
F |
Missing: evidence, reference | |||||
GO:0006099 |
tricarboxylic acid cycle |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0816 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006810 |
transport |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0813 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0009055 |
electron carrier activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000701 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0009055 |
electron carrier activity |
PMID:12788489 |
IDA: Inferred from Direct Assay |
F |
Seeded from EcoCyc (v14.0) |
complete | ||
GO:0009060 |
aerobic respiration |
PMID:7783618 |
IEP: Inferred from Expression Pattern |
P |
Seeded from EcoCyc (v14.0) |
complete | ||
GO:0016020 |
membrane |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000701 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016020 |
membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0472 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016021 |
integral to membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0812 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016021 |
integral to membrane |
GO_REF:0000023 |
IEA: Inferred from Electronic Annotation |
SP_SL:SL-9909 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0017004 |
cytochrome complex assembly |
PMID:9521736 |
IMP: Inferred from Mutant Phenotype |
P |
Seeded from EcoCyc (v14.0) |
complete | ||
GO:0020037 |
heme binding |
PMID:9521736 |
IMP: Inferred from Mutant Phenotype |
F |
Seeded from EcoCyc (v14.0) |
complete | ||
GO:0022900 |
electron transport chain |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0249 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
Partner Type | Partner | Notes | References | Evidence |
---|---|---|---|---|
Protein |
Subunits of membrane-bound subcomplex of succinate dehydrogenase |
could be indirect |
||
Protein |
Subunits of succinate dehydrogenase |
could be indirect |
| |
edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
Compartment | Description | Evidence | Reference/Source | Notes |
---|---|---|---|---|
plasma membrane |
C-terminus localized to the periplasm with 3 predicted transmembrane domains |
Daley et al. (2005) [7] |
||
plasma membrane |
From EcoCyc[3] |
| ||
edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
Name | |
---|---|
Sequence |
MVSNASALGR NGVHDFILVR ATAIVLTLYI IYMVGFFATS GELTYEVWIG FFASAFTKVF TLLALFSILI HAWIGMWQVL TDYVKPLALR LMLQLVIVVA LVVYVIYGFV VVWGV |
Length |
115 |
Mol. Wt |
12.867 kDa |
pI |
7.9 (calculated) |
Extinction coefficient |
30,940 (calc based on 6 Y, 4 W, and 0 C residues) |
edit table |
Domains/Motifs/Modification Sites
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
Resource type | Source | Notes/Reference |
---|---|---|
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
ASAP:ABE-0002464 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EcoCyc:EG10934 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10934 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
RegulonDB:ECK120000923 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB0927 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
---|---|---|---|---|---|---|---|
Protein |
E. coli K-12 MG1655 |
2341 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
2508 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
1273 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
![]() Figure courtesy of RegulonDB |
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:754763..754803
source=MG1655
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
Allele Name | Mutation | Phenotype | Reference |
---|---|---|---|
edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
Type | Reference | Notes |
---|---|---|
microarray |
NCBI GEO profiles for sdhD | |
microarray |
Summary of data for sdhD from multiple microarray studies | |
edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
Resource Name | Resource Type | Description | Source | Notes |
---|---|---|---|---|
edit table |
<protect></protect>
Notes
Accessions Related to sdhD Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG10934 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB0927 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10934 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120000923 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0002464 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
Organism | Homologs (Statistics) | Comments |
---|---|---|
Shigella flexneri |
SDHD |
From SHIGELLACYC |
E. coli O157 |
SDHD |
From ECOO157CYC |
edit table |
<protect></protect>
Notes
Families
<protect>
See Help:Evolution_families for help entering or editing information in this section of EcoliWiki.
Database | Accession | Notes |
---|---|---|
PF01127 Succinate dehydrogenase/Fumarate reductase transmembrane subunit |
| |
edit table |
</protect> <protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 2.11 2.12 2.13 2.14 2.15 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 3.2 3.3 3.4 3.5 3.6 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ Daley, DO et al. (2005) Global topology analysis of the Escherichia coli inner membrane proteome. Science 308 1321-3 PubMed
Categories