sdhB:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
sdhB |
|---|---|
| Mnemonic |
Succinate dehydrogenase |
| Synonyms |
ECK0713, b0724, JW0714, dhsB[1] |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
16.31 minutes |
MG1655: 756912..757628 |
||
|
NC_012967: 738480..739196 |
||||
|
NC_012759: 659672..660388 |
||||
|
W3110 |
|
W3110: 758111..758827 |
||
|
DH10B: 809504..810220 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
756912 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
sdhB(del) (Keio:JW0714) |
deletion |
deletion |
|||||
|
sdhB(del)::kan |
deletion |
Biolog:respiration |
unable to respire Acetate |
||||
|
sdhB(del)::kan |
deletion |
Biolog:respiration |
unable to respire a-Ketobutyrate |
||||
|
sdhB(del)::kan |
deletion |
Biolog:respiration |
unable to respire Bromosuccinate |
||||
|
sdhB(del)::kan |
deletion |
Biolog:respiration |
unable to respire L-Aspartate |
||||
|
sdhB(del)::kan |
deletion |
Biolog:respiration |
unable to respire L-Serine |
||||
|
sdhB774(del)::kan |
|||||||
|
sdhB774(del)::FRTKanFRT |
deletion |
Mutagenesis Rate |
Decrease in Stress Induced Mutagenesis (SIM). |
Parent Strain: SMR4562 Experimental Strain: SMR12332 |
The mutation conferred a significant decrease in SIM with a 67 to 89 percent reduction in mutant frequency. See table S3 for full experimental results. | ||
|
sdhB774(del)::FRTKanFRT |
deletion |
Sensitivity to |
SDS-EDTA Sensitivity |
Parent Strain: SMR4562 Experimental Strain: SMR12332 |
The mutation conferred increased sensitivity toward SDS-EDTA. See table S7 and S1 for summary of experimental data. | ||
|
SMR4562 yiaG-yfp FRTcatFRT sdhB774(del)::FRTKanFRT |
deletion |
SigmaS activity |
Decrease in SigmaS activity |
Parental Strain: SMR10582 Experimental Strain: SMR14297 |
See table S8 for full experimental strain | ||
|
CAG45114 sdhB774(del)::FRTKanFRT |
Deletion |
SigmaE activity |
Decrease in sigmaE activity |
Parental Strain: CAG45114 Experimental Strain: SMR15261 |
See table S11 for full experimental data. | ||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0714 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAGACTCGAGTTTTCAATTTA Primer 2:CCCGCATTACGTTGCAACAACAT | |
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 6% [9] | ||
|
Linked marker |
est. P1 cotransduction: 43% [9] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Link, AJ et al. (1997) Comparing the predicted and observed properties of proteins encoded in the genome of Escherichia coli K-12. Electrophoresis 18 1259-313 PubMed
- ↑ 3.0 3.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
- ↑ 5.0 5.1 5.2 5.3 5.4 Ito, M et al. (2005) Functional analysis of 1440 Escherichia coli genes using the combination of knock-out library and phenotype microarrays. Metab. Eng. 7 318-27 PubMed
- ↑ 6.0 6.1 6.2 6.3 Al Mamun, AA et al. (2012) Identity and function of a large gene network underlying mutagenic repair of DNA breaks. Science 338 1344-8 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 9.0 9.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).