rpoS:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
rpoS |
|---|---|
| Mnemonic |
RNA polymerase subunit |
| Synonyms |
ECK2736, b2741, JW5437, abrD, appR, dpeB, katF, nur, csi2, otsX, sigS[1], sigS |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
61.74 minutes |
MG1655: 2865573..2864581 |
||
|
NC_012967: 2762412..2761420 |
||||
|
NC_012759: 2750393..2751385 |
||||
|
W3110 |
|
W3110: 2866090..2865215 |
||
|
DH10B: 2958115..2957123 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
rpoS(del) (Keio:JW5437) |
deletion |
deletion |
|||||
|
rpoS::Tn5KAN-I-SceI (FB20919) |
Insertion at nt 397 in Plus orientation |
contains pKD46 | |||||
|
rpoS(del)::kan |
deletion |
Biolog:respiration |
unable to respire a-Hydroxybutyrate |
||||
|
rpoS(del)::kan |
deletion |
Biolog:respiration |
unable to respire a-Ketobutyrate |
||||
|
rpoS819 |
Growth Phenotype |
pH dependent GASP phenotype | |||||
|
rpoS1003 |
|||||||
|
rpoS396(Am) |
amber (UAG) mutation | ||||||
|
rpoS(del)1271 |
|||||||
|
rpoS(del)1270 |
|||||||
|
rpoS(del)746::kan |
|||||||
|
rpoS(del) |
Sensitivity to |
increased sensitivity to ozone (6 ug/ml in saline) |
data in Table 1 | ||||
|
rpoS+ |
overexpression |
an increase in expression of rpoS after 15 min of heat stress in biofilm mode and planktonic phase, figure 7. |
|||||
|
rpoS |
expression |
Variation in the pH change induces the expression of rpoS up to 3.5-5.5 fold increase under biofilm mode of growth, figure 6. |
|||||
|
rpoS(del) |
deletion |
deletion |
Auxotrophies |
PoxB activity was almost completely abolished in rpoS null mutant, fig 1, 3. |
|||
|
rpoS359::Tn10 |
Auxotrophies |
Inactivation of the rpoS gene reduced the SOS induction of the sbmC gene, figure 1A. |
|||||
|
rpoS746(del)::FRTKanFRT |
deletion |
Catalase activity |
Decrease in Catalase Activity |
Parent Strain: SMR10582 Experimental Strain: SMR12261 |
The mutation caused a decrease in catalase activity. See table S8 for experimental data. | ||
|
rpoS746(del)::FRTKanFRT |
deletion |
Sigma E Activity |
Decrease in sigma E Activity |
Parent Strain: SMR10582 Experimental Strain: SMR12261 |
The mutation caused a decrease in Sigma E activity. See table S8 for full experimental data. | ||
|
SMR4562 yiaG-yfp FRTcatFRT rpoS746(del)::FRTKanFRT |
SigmaS activity |
Decrease in SigmaS activity |
Parent Strain: SMR10582 Experimental Strain: SMR12661 |
The mutation conferred a decrease in SigmaS activity. See Table S8 for full experimental results. | |||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW5437 |
Plasmid clone |
Status:Clone OK Primer 1:GCCGCCGAAGAGGAACTGTTATC Primer 2:CCtTCGCGGAACAGCGCTTCGAT | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 19% [15] | ||
|
Linked marker |
est. P1 cotransduction: 46% [15] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 3.0 3.1 3.2 CGSC: The Coli Genetics Stock Center
- ↑ Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed
- ↑ 5.0 5.1 Ito, M et al. (2005) Functional analysis of 1440 Escherichia coli genes using the combination of knock-out library and phenotype microarrays. Metab. Eng. 7 318-27 PubMed
- ↑ Farrell, MJ & Finkel, SE (2003) The growth advantage in stationary-phase phenotype conferred by rpoS mutations is dependent on the pH and nutrient environment. J. Bacteriol. 185 7044-52 PubMed
- ↑ Visick, JE & Clarke, S (1997) RpoS- and OxyR-independent induction of HPI catalase at stationary phase in Escherichia coli and identification of rpoS mutations in common laboratory strains. J. Bacteriol. 179 4158-63 PubMed
- ↑ Patil, S et al. (2011) Assessing the microbial oxidative stress mechanism of ozone treatment through the responses of Escherichia coli mutants. J. Appl. Microbiol. 111 136-44 PubMed
- ↑ 9.0 9.1 Adnan, M et al. (2011) Analysis of rpoS and bolA gene expression under various stress-induced environments in planktonic and biofilm phase using 2(-ΔΔCT) method. Mol. Cell. Biochem. 357 275-82 PubMed
- ↑ Chang, YY et al. (1994) Expression of Escherichia coli pyruvate oxidase (PoxB) depends on the sigma factor encoded by the rpoS(katF) gene. Mol. Microbiol. 11 1019-28 PubMed
- ↑ Oh, TJ et al. (2001) The Escherichia coli SOS gene sbmC is regulated by H-NS and RpoS during the SOS induction and stationary growth phase. Biochem. Biophys. Res. Commun. 288 1052-8 PubMed
- ↑ 12.0 12.1 12.2 Al Mamun, AA et al. (2012) Identity and function of a large gene network underlying mutagenic repair of DNA breaks. Science 338 1344-8 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 14.0 14.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 15.0 15.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).