{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

On One Page

Quickview |

Gene |

Product(s) |

Expression|

Evolution |

References |

Quickview

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Standard Name	rnpA
Gene Synonym(s)	ECK3696, b3704, JW3681, rnp, C5^[1]^[2]
Product Desc.	RNase P protein component; processes tRNA, 4.5S RNA^[2]^[3]; Component of RNase P^[3] RNase P, C5 protein component; involved in tRNA and 4.5S RNA-processing^[4]
Product Synonyms(s)	protein C5 component of RNase P^[1], B3704^[2]^[1], RnpA^[2]^[1], C5^[2]^[1], Rnp^[2]^[1] , ECK3696, JW3681, b3704
Function from GO	<GO_nr />
Knock-Out Phenotype
Regulation/Expression	transcription unit(s): rpmH-rnpA^[2]
Regulation/Activity
Quick Links
edit table

See Help:Quickview for help with entering information in the Quickview table.

Notes

[back to top]

Has leadzyme properties.^[4]

Gene

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

[back to top]

See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name	rnpA
Mnemonic	RNase P
Synonyms	ECK3696, b3704, JW3681, rnp, C5^[1]^[2]
edit table

Notes

Location(s) and DNA Sequence

[back to top]

See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain	Map location	Genome coordinates	Genome browsers	Sequence links
MG1655	83.68 minutes	MG1655: 3882516..3882875 <gbrowseImage> name=NC_000913:3882516..3882875 source=MG1655 preset=GeneLocation </gbrowseImage>	EcoCyc GBrowse(MG1655)	FASTA Dump EcoCyc Sequence Dump
REL606		NC_012967: 3844854..3845213 <gbrowseImage> name=NC_012967:3844854..3845213 source=REL606 preset=GeneLocation </gbrowseImage>	GBrowse (REL606)	FASTA Dump
BW2952		NC_012759: 3770849..3771208 <gbrowseImage> name=NC_012759:3770849..3771208 source=BW2952 preset=GeneLocation </gbrowseImage>	GBrowse (BW2952)	FASTA Dump
W3110		W3110: 3755922..3755563 <gbrowseImage> name=NC_007779:3755563..3755922 source=W3110 preset=GeneLocation </gbrowseImage>	GBrowse(W3110)	FASTA Dump
DH10B		DH10B: 3980100..3980459 <gbrowseImage> name=NC_010473:3980100..3980459 source=DH10B preset=GeneLocation </gbrowseImage>	GBrowse(DH10B)	FASTA Dump
edit table

Notes

Sequence Features

[back to top]

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type	Strain	Genomic Location	Evidence	Reference	Notes
edit table

Notes

Alleles and Phenotypes

[back to top]

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele	Nt change(s)	AA change(s)	Phenotype: Type	Phenotype: Description	Reference	Availability	Comments
rnpA49(ts)				temperature sensitive		CGSC:12894
edit table

Notes

Genetic Interactions

[back to top]

Interactor	Interaction	Allele	Score(s)	Reference(s)	Accessions	Notes
edit table

Notes

Genetic Resources

[back to top]

See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource	Resource Type	Source	Notes/Reference
JW3681	Plasmid clone	Shigen	PMID:16769691 Status:Clone OK Primer 1:GCCGTTAAGCTCGCATTTCCCAG Primer 2:CCGGACCCGCGAGCCAGGCGACA
3F11	Kohara Phage	Genobase	PMID:3038334
3C10	Kohara Phage	Genobase	PMID:3038334
zid-501::Tn10	Linked marker	CAG18499 = CGSC7458^[5]	est. P1 cotransduction: 75% ^[6]
rbsD296::Tn10	Linked marker	CAG18501 = CGSC7460^[5]	est. P1 cotransduction: 12% ^[6] Synonyms:zie-296::Tn10
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG10862	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10862	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000853	Escherichia coli str. K-12 substr. MG1655
NCBI (EcoliWiki Page)	GeneID:948215	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0855	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0012117	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Product(s)

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name	RnpA
Synonyms	protein C5 component of RNase P^[1], B3704^[2]^[1], RnpA^[2]^[1], C5^[2]^[1], Rnp^[2]^[1] , ECK3696, JW3681, b3704
Product description	RNase P protein component; processes tRNA, 4.5S RNA^[2]^[3]; Component of RNase P^[3] RNase P, C5 protein component; involved in tRNA and 4.5S RNA-processing^[4]
EC number (for enzymes)	3.1.26.5^[1]
edit table

Notes

Function

[back to top]

Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier	GO ID	GO term name	Reference	Evidence Code	with/from	Aspect	Notes	Status
	GO:0005737	cytoplasm				C	Seeded from Riley et al 2006 ^[1].	Missing: evidence, reference
	GO:0000049	tRNA binding	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_00227	F	Seeded from EcoCyc (v14.0)	complete
	GO:0000049	tRNA binding	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR000100	F	Seeded from EcoCyc (v14.0)	complete
	GO:0001682	tRNA 5'-leader removal	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_00227	P	Seeded from EcoCyc (v14.0)	complete
	GO:0003723	RNA binding	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0694	F	Seeded from EcoCyc (v14.0)	complete
	GO:0004518	nuclease activity	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0540	F	Seeded from EcoCyc (v14.0)	complete
	GO:0004519	endonuclease activity	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0255	F	Seeded from EcoCyc (v14.0)	complete
	GO:0004526	ribonuclease P activity	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_00227	F	Seeded from EcoCyc (v14.0)	complete
	GO:0004526	ribonuclease P activity	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR000100	F	Seeded from EcoCyc (v14.0)	complete
	GO:0004526	ribonuclease P activity	GOA:spec GO_REF:0000003	IEA: Inferred from Electronic Annotation	EC:3.1.26.5	F	Seeded from EcoCyc (v14.0)	complete
	GO:0008033	tRNA processing	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR000100	P	Seeded from EcoCyc (v14.0)	complete
	GO:0008033	tRNA processing	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0819	P	Seeded from EcoCyc (v14.0)	complete
	GO:0016787	hydrolase activity	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0378	F	Seeded from EcoCyc (v14.0)	complete
	GO:0006396	RNA processing	PMID:794064^[7]	IDA: Inferred from Direct Assay		P		complete
	GO:0001682	tRNA 5'-leader removal	PMID:167017^[8]	IDA: Inferred from Direct Assay		P		complete
edit table

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type	Partner	Notes	References	Evidence
Protein	Subunits of RNase P	could be indirect
Protein	rplB		PMID:16606699^[9]	Experiment(s):EBI-1146535
Protein	rpsD		PMID:16606699^[9]	Experiment(s):EBI-1146535
Protein	cybC		PMID:16606699^[9]	Experiment(s):EBI-1146535
Protein	yqgF		PMID:16606699^[9]	Experiment(s):EBI-1146535
Protein	dnaK		PMID:16606699^[9]	Experiment(s):EBI-1146535
Protein	aceF		PMID:15690043^[10]	Experiment(s):EBI-879914
Protein	deaD		PMID:15690043^[10]	Experiment(s):EBI-879914
Protein	lpdA		PMID:15690043^[10]	Experiment(s):EBI-879914
Protein	ppk		PMID:15690043^[10]	Experiment(s):EBI-879914
Protein	pssA		PMID:15690043^[10]	Experiment(s):EBI-879914, EBI-884810
Protein	rho		PMID:15690043^[10]	Experiment(s):EBI-879914
Protein	rplA		PMID:15690043^[10]	Experiment(s):EBI-879914, EBI-884810
Protein	rplB		PMID:15690043^[10]	Experiment(s):EBI-879914, EBI-884810
Protein	rplC		PMID:15690043^[10]	Experiment(s):EBI-879914, EBI-884810
Protein	rpsA		PMID:15690043^[10]	Experiment(s):EBI-879914
Protein	rpsB		PMID:15690043^[10]	Experiment(s):EBI-879914, EBI-884810
Protein	rpsC		PMID:15690043^[10]	Experiment(s):EBI-879914, EBI-884810
Protein	rpsD		PMID:15690043^[10]	Experiment(s):EBI-879914
Protein	rpsE		PMID:15690043^[10]	Experiment(s):EBI-879914, EBI-884810
Protein	rpsG		PMID:15690043^[10]	Experiment(s):EBI-879914, EBI-884810
Protein	rpsH		PMID:15690043^[10]	Experiment(s):EBI-879914, EBI-884810
Protein	spoT		PMID:15690043^[10]	Experiment(s):EBI-879914
Protein	ycbY		PMID:15690043^[10]	Experiment(s):EBI-879914
Protein	ycfL		PMID:15690043^[10]	Experiment(s):EBI-879914
Protein	rluB		PMID:15690043^[10]	Experiment(s):EBI-879914
Protein	yfiF		PMID:15690043^[10]	Experiment(s):EBI-879914
Protein	clpA		PMID:15690043^[10]	Experiment(s):EBI-879914
Protein	rpsM		PMID:15690043^[10]	Experiment(s):EBI-879914, EBI-884810
Protein	hupA		PMID:15690043^[10]	Experiment(s):EBI-884810
Protein	rplD		PMID:15690043^[10]	Experiment(s):EBI-884810
Protein	rplF		PMID:15690043^[10]	Experiment(s):EBI-884810
Protein	rplI		PMID:15690043^[10]	Experiment(s):EBI-884810
Protein	rplK		PMID:15690043^[10]	Experiment(s):EBI-884810
Protein	rplL		PMID:15690043^[10]	Experiment(s):EBI-884810
Protein	rplM		PMID:15690043^[10]	Experiment(s):EBI-884810
Protein	rplN		PMID:15690043^[10]	Experiment(s):EBI-884810
Protein	rplO		PMID:15690043^[10]	Experiment(s):EBI-884810
Protein	rplP		PMID:15690043^[10]	Experiment(s):EBI-884810
Protein	rplQ		PMID:15690043^[10]	Experiment(s):EBI-884810
Protein	rplR		PMID:15690043^[10]	Experiment(s):EBI-884810
Protein	rplS		PMID:15690043^[10]	Experiment(s):EBI-884810
Protein	rplT		PMID:15690043^[10]	Experiment(s):EBI-884810
Protein	rplU		PMID:15690043^[10]	Experiment(s):EBI-884810
Protein	rplV		PMID:15690043^[10]	Experiment(s):EBI-884810
Protein	rplX		PMID:15690043^[10]	Experiment(s):EBI-884810
Protein	rpmC		PMID:15690043^[10]	Experiment(s):EBI-884810
Protein	rpsF		PMID:15690043^[10]	Experiment(s):EBI-884810
Protein	rpsI		PMID:15690043^[10]	Experiment(s):EBI-884810
Protein	rpsJ		PMID:15690043^[10]	Experiment(s):EBI-884810
Protein	rpsK		PMID:15690043^[10]	Experiment(s):EBI-884810
Protein	rpsN		PMID:15690043^[10]	Experiment(s):EBI-884810
Protein	rpsO		PMID:15690043^[10]	Experiment(s):EBI-884810
Protein	rpsP		PMID:15690043^[10]	Experiment(s):EBI-884810
Protein	rpsR		PMID:15690043^[10]	Experiment(s):EBI-884810
Protein	rpsT		PMID:15690043^[10]	Experiment(s):EBI-884810
Protein	rpsU		PMID:15690043^[10]	Experiment(s):EBI-884810
Protein	rpmC		PMID:19402753^[11]	LCMS(ID Probability):99.6
Protein	rpmB		PMID:19402753^[11]	LCMS(ID Probability):99.6
Protein	rho		PMID:19402753^[11]	MALDI(Z-score):36.660582
Protein	rplN		PMID:19402753^[11]	LCMS(ID Probability):99.6
Protein	rplO		PMID:19402753^[11]	LCMS(ID Probability):99.6
Protein	rplP		PMID:19402753^[11]	LCMS(ID Probability):99.6
Protein	rpsH		PMID:19402753^[11]	LCMS(ID Probability):99.6 MALDI(Z-score):11.401811
Protein	rplS		PMID:19402753^[11]	LCMS(ID Probability):99.6
Protein	rplT		PMID:19402753^[11]	LCMS(ID Probability):99.6
Protein	hupA		PMID:19402753^[11]	LCMS(ID Probability):99.6
Protein	rpsI		PMID:19402753^[11]	LCMS(ID Probability):99.6
Protein	rpsP		PMID:19402753^[11]	LCMS(ID Probability):99.6
Protein	rpsT		PMID:19402753^[11]	LCMS(ID Probability):99.6
Protein	rpsJ		PMID:19402753^[11]	LCMS(ID Probability):99.6
Protein	rpsF		PMID:19402753^[11]	LCMS(ID Probability):99.6
Protein	rpsN		PMID:19402753^[11]	LCMS(ID Probability):99.6
Protein	rplX		PMID:19402753^[11]	LCMS(ID Probability):99.6
Protein	rpsS		PMID:19402753^[11]	LCMS(ID Probability):99.6
Protein	rpsM		PMID:19402753^[11]	LCMS(ID Probability):99.6 MALDI(Z-score):15.423817
Protein	rpsA		PMID:19402753^[11]	MALDI(Z-score):26.730017
Protein	rplR		PMID:19402753^[11]	LCMS(ID Probability):99.6
Protein	rplU		PMID:19402753^[11]	LCMS(ID Probability):99.6
Protein	rplA		PMID:19402753^[11]	LCMS(ID Probability):99.6 MALDI(Z-score):22.431914
Protein	rpsR		PMID:19402753^[11]	LCMS(ID Probability):99.6
Protein	rplM		PMID:19402753^[11]	LCMS(ID Probability):99.6 MALDI(Z-score):2.512944
Protein	rplB		PMID:19402753^[11]	LCMS(ID Probability):99.6 MALDI(Z-score):38.309788
Protein	rplF		PMID:19402753^[11]	LCMS(ID Probability):99.4
Protein	rpsK		PMID:19402753^[11]	LCMS(ID Probability):99.6
Protein	rpsC		PMID:19402753^[11]	LCMS(ID Probability):99.6 MALDI(Z-score):38.220722
Protein	rplQ		PMID:19402753^[11]	LCMS(ID Probability):99.6
Protein	rpsD		PMID:19402753^[11]	LCMS(ID Probability):99.6 MALDI(Z-score):36.752884
Protein	ppk		PMID:19402753^[11]	MALDI(Z-score):26.012222
Protein	clpA		PMID:19402753^[11]	MALDI(Z-score):23.165660
Protein	rlmL		PMID:19402753^[11]	MALDI(Z-score):38.289465
Protein	rpsO		PMID:19402753^[11]	LCMS(ID Probability):99.6
Protein	rpsU		PMID:19402753^[11]	LCMS(ID Probability):99.6
Protein	yhbY		PMID:19402753^[11]	LCMS(ID Probability):99.6
Protein	rplD		PMID:19402753^[11]	LCMS(ID Probability):99.6 MALDI(Z-score):2.762093
Protein	pnp		PMID:19402753^[11]	MALDI(Z-score):20.141615
Protein	pssA		PMID:19402753^[11]	LCMS(ID Probability):99.6 MALDI(Z-score):28.707857
Protein	infC		PMID:19402753^[11]	LCMS(ID Probability):99.6
Protein	rluC		PMID:19402753^[11]	MALDI(Z-score):18.733516
Protein	yfiF		PMID:19402753^[11]	MALDI(Z-score):32.084556
Protein	rluB		PMID:19402753^[11]	LCMS(ID Probability):92.5 MALDI(Z-score):29.121433
Protein	deaD		PMID:19402753^[11]	MALDI(Z-score):21.050659
Protein	ycfL		PMID:19402753^[11]	MALDI(Z-score):17.053160
Protein	rplL		PMID:19402753^[11]	LCMS(ID Probability):99.6
edit table

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment	Description	Evidence	Reference/Source	Notes
plasma membrane			From EcoCyc^[3]
edit table

Notes

Structure and Physical Properties

[back to top]

Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence	at EcoCyc MVKLAFPREL RLLTPSQFTF VFQQPQRAGT PQITILGRLN SLGHPRIGLT VAKKNVRRAH ERNRIKRLTR ESFRLRQHEL PAMDFVVVAK KGVADLDNRA LSEALEKLWR RHCRLARGS
Length	119
Mol. Wt	13.789 kDa
pI	12.3 (calculated)
Extinction coefficient	5,500 - 5,625 (calc based on 0 Y, 1 W, and 1 C residues)
edit table

Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type	Residues	Description	Notes	References
Domain	6..113	PF00825 Ribonuclease P		PMID:19920124^[12]
edit table

<motif_map/>

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=rnpA taxon=562,83333 </beststructure>

Models

View models at:

edit table

Structure figures

Notes

Gene Product Resources

[back to top]

See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type	Source	Notes/Reference
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
NCBI (Protein) (EcoliWiki Page)	GI:16131572	Escherichia coli str. K-12 substr. MG1655
NCBI (Protein) (EcoliWiki Page)	GeneID:948215	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0012117	Escherichia coli str. K-12 substr. MG1655
UniProt (EcoliWiki Page)	UniProtKB/Swiss-Prot:P0A7Y8	Escherichia coli str. K-12 substr. MG1655
EcoCyc	EcoCyc:EG10862	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10862	Escherichia coli str. K-12 substr. MG1655
NCBI (Gene) (EcoliWiki Page)	GeneID:948215	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000853	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0855	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Expression

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Cellular Levels

[back to top]

See Help:Cellular levels

Molecule	Organism or Strain	Value	Units	Experimental Conditions	Assay used	Notes	Reference(s)
Protein	Ecoli K-12	30.117+/-0.207	Molecules/cell	Medium: Temperature (°C): Doubling time (min): Growth Rate(min): * Growth phase: other: *		Single Molecule Fluorescence	PMID:20671182
mRNA	Ecoli K-12	0.167130919	Molecules/cell	Medium: Temperature (°C): Doubling time (min): Growth Rate(min): * Growth phase: other: *		by RNA_Seq	PMID:20671182
Protein	E. coli K-12 MG1655	1940	molecules/cell/generation	Medium: MOPS Complete Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	363	molecules/cell/generation	Medium: MOPS Minimal Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	498	molecules/cell/generation	Medium: MOPS Complete without Methionine Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
edit table

Notes

Transcription and Transcriptional Regulation

[back to top]

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)
rpmH-rnpA
edit table

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]

<gbrowseImage> name=NC_000913:3882496..3882536 source=MG1655 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]

Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name	Mutation	Phenotype	Reference
edit table

Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type	Reference	Notes
microarray	GEO Profiles:b3704 (EcoliWiki Page)	NCBI GEO profiles for rnpA
microarray	GenExpDB:b3704 (EcoliWiki Page)	Summary of data for rnpA from multiple microarray studies
edit table

Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name	Resource Type	Description	Source	Notes
edit table

Notes

Accessions Related to rnpA Expression

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG10862	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0855	Escherichia coli str. K-12 substr. MG1655
EcoliGenExpDB (EcoliWiki Page)	EcoliGenExpDB:b3704
EcoGene	EcoGene:EG10862	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000853	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0012117	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Evolution

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]

See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism	Homologs (Statistics)	Comments
Xenopus tropicalis	ENSXETP00000023312 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Shigella flexneri	RNPA	From SHIGELLACYC
E. coli O157	RNPA	From ECOO157CYC
edit table

Do-It-Yourself Web Tools

Notes

Families

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
Superfamily (EcoliWiki Page)	SUPERFAMILY:54211
Pfam (EcoliWiki Page)	PF00825 Ribonuclease P
EcoCyc	EcoCyc:EG10862	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10862	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000853	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0855	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0012117	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

References

[back to top]

See Help:References for how to manage references in EcoliWiki.

↑ ^1.00 ^1.01 ^1.02 ^1.03 ^1.04 ^1.05 ^1.06 ^1.07 ^1.08 ^1.09 ^1.10 ^1.11 ^1.12 ^1.13 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
↑ ^2.00 ^2.01 ^2.02 ^2.03 ^2.04 ^2.05 ^2.06 ^2.07 ^2.08 ^2.09 ^2.10 ^2.11 ^2.12 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^3.0 ^3.1 ^3.2 ^3.3 ^3.4 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^4.0 ^4.1 ^4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
↑ ^5.0 ^5.1 CGSC: The Coli Genetics Stock Center
↑ ^6.0 ^6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
↑ Bothwell, AL et al. (1976) Nucleotide sequence and in vitro processing of a precursor molecule to Escherichia coli 4.5 S RNA. J. Biol. Chem. 251 7709-16 PubMed
↑ Chang, S & Carbon, J (1975) The nucleotide sequence of a precursor to the glycine- and threonine-specific transfer ribonucleic acids of Escherichia coli. J. Biol. Chem. 250 5542-55 PubMed
↑ ^9.0 ^9.1 ^9.2 ^9.3 ^9.4 Arifuzzaman, M et al. (2006) Large-scale identification of protein-protein interaction of Escherichia coli K-12. Genome Res. 16 686-91 PubMed
↑ ^10.00 ^10.01 ^10.02 ^10.03 ^10.04 ^10.05 ^10.06 ^10.07 ^10.08 ^10.09 ^10.10 ^10.11 ^10.12 ^10.13 ^10.14 ^10.15 ^10.16 ^10.17 ^10.18 ^10.19 ^10.20 ^10.21 ^10.22 ^10.23 ^10.24 ^10.25 ^10.26 ^10.27 ^10.28 ^10.29 ^10.30 ^10.31 ^10.32 ^10.33 ^10.34 ^10.35 ^10.36 ^10.37 ^10.38 ^10.39 ^10.40 ^10.41 ^10.42 ^10.43 ^10.44 ^10.45 ^10.46 ^10.47 ^10.48 ^10.49 ^10.50 Butland, G et al. (2005) Interaction network containing conserved and essential protein complexes in Escherichia coli. Nature 433 531-7 PubMed
↑ ^11.00 ^11.01 ^11.02 ^11.03 ^11.04 ^11.05 ^11.06 ^11.07 ^11.08 ^11.09 ^11.10 ^11.11 ^11.12 ^11.13 ^11.14 ^11.15 ^11.16 ^11.17 ^11.18 ^11.19 ^11.20 ^11.21 ^11.22 ^11.23 ^11.24 ^11.25 ^11.26 ^11.27 ^11.28 ^11.29 ^11.30 ^11.31 ^11.32 ^11.33 ^11.34 ^11.35 ^11.36 ^11.37 ^11.38 ^11.39 ^11.40 ^11.41 ^11.42 ^11.43 ^11.44 ^11.45 ^11.46 Hu, P et al. (2009) Global functional atlas of Escherichia coli encompassing previously uncharacterized proteins. PLoS Biol. 7 e96 PubMed
↑ Finn, RD et al. (2010) The Pfam protein families database. Nucleic Acids Res. 38 D211-22 PubMed

rnpA:On One Page

Quickview

Notes

Gene

Nomenclature

Notes

Location(s) and DNA Sequence

Notes

Sequence Features

Notes

Alleles and Phenotypes

Notes

Genetic Interactions

Notes

Genetic Resources

Notes

Accessions in Other Databases

Notes

Links

Product(s)

Nomenclature

Notes

Function

Notes

Localization

Notes

Structure and Physical Properties

Structure figures

Notes

Gene Product Resources

Notes

Accessions in Other Databases

Notes

Links

Expression

Overview

Cellular Levels

Notes

Transcription and Transcriptional Regulation

Notes

Translation and Regulation of Translation

Notes

Turnover and Regulation of Turnover

Notes

Experimental

Notes

Accessions Related to rnpA Expression

Notes

Links

Evolution

Homologs in Other Organisms

Do-It-Yourself Web Tools

Notes

Families

Notes

Links

References

Categories

Navigation menu

Search