{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

On One Page

Quickview |

Gene |

Product(s) |

Expression|

Evolution |

References |

Quickview

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Standard Name	pyrH
Gene Synonym(s)	ECK0170, b0171, JW0166, smbA, umk^[1], umk
Product Desc.	UMPKI^[2]^[3]; Component of uridylate kinase^[2]^[3] UMP kinase; hexameric; essential gene^[4]
Product Synonyms(s)	uridylate kinase^[1], B0171^[2]^[1], Umk^[2]^[1], SmbA^[2]^[1], PyrH^[2]^[1] , ECK0170, JW0166, smbA, umk, b0171
Function from GO	<GO_nr />
Knock-Out Phenotype
Regulation/Expression	transcription unit(s): pyrH^[2]
Regulation/Activity
Quick Links
edit table

</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>

Notes

[back to top]

Binds TrxA (Kumar, 2004).^[4]

Gene

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css> <protect>

Nomenclature

[back to top]

See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name	pyrH
Mnemonic	Pyrimidine
Synonyms	ECK0170, b0171, JW0166, smbA, umk^[1], umk
edit table

</protect>

Notes

Location(s) and DNA Sequence

[back to top]

<protect> See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain	Map location	Genome coordinates	Genome browsers	Sequence links
MG1655	4.14 minutes	MG1655: 191855..192580 <gbrowseImage> name=NC_000913:191855..192580 source=MG1655 preset=GeneLocation </gbrowseImage>	EcoCyc GBrowse(MG1655)	FASTA Dump EcoCyc Sequence Dump
REL606		NC_012967: 194697..195422 <gbrowseImage> name=NC_012967:194697..195422 source=REL606 preset=GeneLocation </gbrowseImage>	GBrowse (REL606)	FASTA Dump
BW2952		NC_012759: 191854..192579 <gbrowseImage> name=NC_012759:191854..192579 source=BW2952 preset=GeneLocation </gbrowseImage>	GBrowse (BW2952)	FASTA Dump
W3110		W3110: 191855..192580 <gbrowseImage> name=NC_007779:191855..192580 source=W3110 preset=GeneLocation </gbrowseImage>	GBrowse(W3110)	FASTA Dump
DH10B		DH10B: 165959..166684 <gbrowseImage> name=NC_010473:165959..166684 source=DH10B preset=GeneLocation </gbrowseImage>	GBrowse(DH10B)	FASTA Dump
edit table

</protect>

Notes

Sequence Features

[back to top]

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type	Strain	Genomic Location	Evidence	Reference	Notes
Coding Start (SO:0000323)	MG1655	191858	Edman degradation	PMID:7711027
edit table

Notes

Alleles and Phenotypes

[back to top]

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele	AA change(s)	Phenotype: Description	Availability	Comments
pyrHR62H	R62H	(in Smba9)		Strain variation; seeded from UniProt:P0A7E9
pyrHD201N	D201N	(in Smba2)		Strain variation; seeded from UniProt:P0A7E9
pyrHD174N	D174N	Reduced UMP-binding affinity		seeded from UniProt:P0A7E9
pyrHD159N	D159N	Increased solubility at neutral pH. Nearly no change in kinetic properties and stability		seeded from UniProt:P0A7E9
pyrHD201N	D201N	Loss of activation by GTP		seeded from UniProt:P0A7E9
pyrHR62H	R62H	Loss of activation by GTP and decreased affinity for UTP		seeded from UniProt:P0A7E9
pyrHD77N	D77N	Loss of activation by GTP and decreased affinity for UTP		seeded from UniProt:P0A7E9
pyrHT138A	T138A	Loss of activation by GTP. Moderate loss of sensitivity to UTP inhibition. 4- fold and 2-fold decrease in affinity for UMP and ATP, respectively		seeded from UniProt:P0A7E9
pyrHN140A	N140A	Loss of activation by GTP. Moderate loss of sensitivity to UTP inhibition		seeded from UniProt:P0A7E9
pyrHD146N	D146N	Drastically reduced activity		seeded from UniProt:P0A7E9
pyrH78			CGSC:8636
edit table

Notes

Genetic Interactions

[back to top]

Interactor	Interaction	Allele	Score(s)	Reference(s)	Accessions	Notes
edit table

</protect>

Notes

Genetic Resources

[back to top]

See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource	Resource Type	Source	Notes/Reference
JW0166	Plasmid clone	Shigen	PMID:16769691 Status:Clone OK Primer 1:GCCGCTACCAATGCAAAACCCGT Primer 2:CCTTCCGTGATTAAAGTCCCTTC
21C8	Kohara Phage	Genobase	PMID:3038334
12D5	Kohara Phage	Genobase	PMID:3038334
zad-220::Tn10	Linked marker	CAG12025 = CGSC7326^[5]	est. P1 cotransduction: 15% ^[6]
yafC502::Tn10	Linked marker	CAG18436 = CGSC7328^[5]	est. P1 cotransduction: 18% ^[6] Synonyms:zae-502::Tn10
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG11539	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG11539	Escherichia coli str. K-12 substr. MG1655
NCBI (EcoliWiki Page)	GeneID:944989	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120001493	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB1501	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0000582	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Product(s)

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name	PyrH
Synonyms	uridylate kinase^[1], B0171^[2]^[1], Umk^[2]^[1], SmbA^[2]^[1], PyrH^[2]^[1] , ECK0170, JW0166, smbA, umk, b0171
Product description	UMPKI^[2]^[3]; Component of uridylate kinase^[2]^[3] UMP kinase; hexameric; essential gene^[4]
EC number (for enzymes)	2.7.4.-^[1]
edit table

Notes

Function

[back to top]

<protect> Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier	GO ID	GO term name	Reference	Evidence Code	with/from	Aspect	Notes	Status
	GO:0000166	nucleotide binding	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0547	F	Seeded from EcoCyc (v14.0)	complete
	GO:0005524	ATP binding	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0067	F	Seeded from EcoCyc (v14.0)	complete
	GO:0005737	cytoplasm	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_01220	C	Seeded from EcoCyc (v14.0)	complete
	GO:0005737	cytoplasm	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR015963	C	Seeded from EcoCyc (v14.0)	complete
	GO:0005737	cytoplasm	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0963	C	Seeded from EcoCyc (v14.0)	complete
	GO:0005737	cytoplasm	GO_REF:0000023	IEA: Inferred from Electronic Annotation	SP_SL:SL-0086	C	Seeded from EcoCyc (v14.0)	complete
	GO:0006221	pyrimidine nucleotide biosynthetic process	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_01220	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006221	pyrimidine nucleotide biosynthetic process	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR011817	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006221	pyrimidine nucleotide biosynthetic process	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR015963	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006221	pyrimidine nucleotide biosynthetic process	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0665	P	Seeded from EcoCyc (v14.0)	complete
	GO:0008652	cellular amino acid biosynthetic process	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR001048	P	Seeded from EcoCyc (v14.0)	complete
	GO:0009041	uridylate kinase activity	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_01220	F	Seeded from EcoCyc (v14.0)	complete
	GO:0009041	uridylate kinase activity	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR011817	F	Seeded from EcoCyc (v14.0)	complete
	GO:0016301	kinase activity	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0418	F	Seeded from EcoCyc (v14.0)	complete
	GO:0016740	transferase activity	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0808	F	Seeded from EcoCyc (v14.0)	complete
	GO:0033862	UMP kinase activity	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR015963	F	Seeded from EcoCyc (v14.0)	complete
	GO:0033862	UMP kinase activity	GOA:spec GO_REF:0000003	IEA: Inferred from Electronic Annotation	EC:2.7.4.22	F	Seeded from EcoCyc (v14.0)	complete
edit table

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type	Partner	Notes	References	Evidence
Protein	Subunits of uridylate kinase	could be indirect
Protein	gatZ		PMID:15690043	Experiment(s):EBI-890235
Protein	recA		PMID:15690043	Experiment(s):EBI-890235
Protein	rho		PMID:15690043	Experiment(s):EBI-890235
Protein	tsf		PMID:16606699	Experiment(s):EBI-1135778
Protein	iaaA		PMID:16606699	Experiment(s):EBI-1135778
Protein	fusA		PMID:15690043	Experiment(s):EBI-895127
Protein	gatA		PMID:15690043	Experiment(s):EBI-895127
Protein	gatB		PMID:15690043	Experiment(s):EBI-895127
Protein	hns		PMID:15690043	Experiment(s):EBI-895127
Protein	degP		PMID:15690043	Experiment(s):EBI-895127
Protein	hupA		PMID:15690043	Experiment(s):EBI-895127
Protein	hupB		PMID:15690043	Experiment(s):EBI-895127
Protein	lpxC		PMID:15690043	Experiment(s):EBI-895127
Protein	groL		PMID:15690043	Experiment(s):EBI-895127
Protein	rplA		PMID:15690043	Experiment(s):EBI-895127
Protein	rplB		PMID:15690043	Experiment(s):EBI-895127
Protein	rplC		PMID:15690043	Experiment(s):EBI-895127
Protein	rplD		PMID:15690043	Experiment(s):EBI-895127
Protein	rplE		PMID:15690043	Experiment(s):EBI-895127
Protein	rplI		PMID:15690043	Experiment(s):EBI-895127
Protein	rplK		PMID:15690043	Experiment(s):EBI-895127
Protein	rplL		PMID:15690043	Experiment(s):EBI-895127
Protein	rplM		PMID:15690043	Experiment(s):EBI-895127
Protein	rplR		PMID:15690043	Experiment(s):EBI-895127
Protein	rplS		PMID:15690043	Experiment(s):EBI-895127
Protein	rplU		PMID:15690043	Experiment(s):EBI-895127
Protein	rplV		PMID:15690043	Experiment(s):EBI-895127
Protein	rplW		PMID:15690043	Experiment(s):EBI-895127
Protein	rpmA		PMID:15690043	Experiment(s):EBI-895127
Protein	rpmG		PMID:15690043	Experiment(s):EBI-895127
Protein	rpsA		PMID:15690043	Experiment(s):EBI-895127
Protein	rpsB		PMID:15690043	Experiment(s):EBI-895127
Protein	rpsC		PMID:15690043	Experiment(s):EBI-895127
Protein	rpsE		PMID:15690043	Experiment(s):EBI-895127
Protein	rpsG		PMID:15690043	Experiment(s):EBI-895127
Protein	rpsJ		PMID:15690043	Experiment(s):EBI-895127
Protein	rpsP		PMID:15690043	Experiment(s):EBI-895127
Protein	secA		PMID:15690043	Experiment(s):EBI-895127
Protein	slyD		PMID:15690043	Experiment(s):EBI-895127
Protein	thiE		PMID:15690043	Experiment(s):EBI-895127
Protein	tufA		PMID:15690043	Experiment(s):EBI-895127
Protein	uspA		PMID:15690043	Experiment(s):EBI-895127
Protein	uspG		PMID:15690043	Experiment(s):EBI-895127
Protein	yfiF		PMID:15690043	Experiment(s):EBI-895127
Protein	yhbY		PMID:15690043	Experiment(s):EBI-895127
Protein	yebT		PMID:15690043	Experiment(s):EBI-895127
Protein	cadB		PMID:15690043	Experiment(s):EBI-895127
Protein	clpA		PMID:15690043	Experiment(s):EBI-895127
Protein	dnaJ		PMID:15690043	Experiment(s):EBI-895127
Protein	dnaK		PMID:15690043	Experiment(s):EBI-895127
Protein	rplO		PMID:19402753	LCMS(ID Probability):99.6
Protein	groL		PMID:19402753	LCMS(ID Probability):99.6
Protein	rpsA		PMID:19402753	LCMS(ID Probability):99.6
Protein	rplA		PMID:19402753	LCMS(ID Probability):99.0 MALDI(Z-score):14.894884
Protein	rpsP		PMID:19402753	LCMS(ID Probability):99.6
Protein	rpsN		PMID:19402753	LCMS(ID Probability):99.6
Protein	rplU		PMID:19402753	LCMS(ID Probability):99.6
Protein	rpsC		PMID:19402753	LCMS(ID Probability):99.0 MALDI(Z-score):13.593031
Protein	rpsF		PMID:19402753	LCMS(ID Probability):99.6
Protein	gatA		PMID:19402753	LCMS(ID Probability):99.0
Protein	rplB		PMID:19402753	LCMS(ID Probability):99.4 MALDI(Z-score):23.928856
Protein	rpsJ		PMID:19402753	LCMS(ID Probability):99.6
Protein	fusA		PMID:19402753	LCMS(ID Probability):99.0
Protein	recA		PMID:19402753	MALDI(Z-score):32.115364
Protein	uspA		PMID:19402753	LCMS(ID Probability):99.0
Protein	gatB		PMID:19402753	LCMS(ID Probability):99.0
Protein	clpA		PMID:19402753	LCMS(ID Probability):99.0
Protein	rplW		PMID:19402753	LCMS(ID Probability):99.6
Protein	yhbY		PMID:19402753	LCMS(ID Probability):99.6
Protein	yebT		PMID:19402753	LCMS(ID Probability):99.0
Protein	degP		PMID:19402753	LCMS(ID Probability):99.0
Protein	cadB		PMID:19402753	LCMS(ID Probability):99.0
Protein	lpxC		PMID:19402753	LCMS(ID Probability):99.0
Protein	thiE		PMID:19402753	LCMS(ID Probability):99.0
edit table

</protect>

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment	Description	Evidence	Reference/Source	Notes
edit table

Notes

Structure and Physical Properties

[back to top]

<protect> Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence	at EcoCyc MATNAKPVYK RILLKLSGEA LQGTEGFGID ASILDRMAQE IKELVELGIQ VGVVIGGGNL FRGAGLAKAG MNRVVGDHMG MLATVMNGLA MRDALHRAYV NARLMSAIPL NGVCDSYSWA EAISLLRNNR VVILSAGTGN PFFTTDSAAC LRGIEIEADV VLKATKVDGV FTADPAKDPT ATMYEQLTYS EVLEKELKVM DLAAFTLARD HKLPIRVFNM NKPGALRRVV MGEKEGTLIT E
Length	241
Mol. Wt	25.97 kDa
pI	7.2 (calculated)
Extinction coefficient	12,950 - 13,200 (calc based on 5 Y, 1 W, and 2 C residues)
edit table

Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type	Residues	Description	Notes	References
Initiator Methionine	1	Removed	UniProt:P0A7E9
Domain	10..219	PF00696 Amino acid kinase family		PMID:19920124
edit table

<motif_map/>

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=pyrH taxon=562,83333 </beststructure>

Models

View models at:

edit table

</protect>

Structure figures

</protect>

Notes

Gene Product Resources

[back to top]

See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type	Source	Notes/Reference
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
NCBI (Protein) (EcoliWiki Page)	GI:16128164	Escherichia coli str. K-12 substr. MG1655
NCBI (Protein) (EcoliWiki Page)	GeneID:944989	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0000582	Escherichia coli str. K-12 substr. MG1655
UniProt (EcoliWiki Page)	UniProtKB/Swiss-Prot:P0A7E9	Escherichia coli str. K-12 substr. MG1655
EcoCyc	EcoCyc:EG11539	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG11539	Escherichia coli str. K-12 substr. MG1655
NCBI (Gene) (EcoliWiki Page)	GeneID:944989	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120001493	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB1501	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Expression

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Cellular Levels

[back to top]

See Help:Cellular levels

Molecule	Organism or Strain	Value	Units	Experimental Conditions	Assay used	Notes	Reference(s)
Protein	E. coli K-12 MC4100	9.05E+02	molecules/cell	Medium: median data from rich and minimal media Temperature (°C): 37 Doubling time (min): Growth Rate(min): Growth phase: other:	emPAI		PMID:18304323
Protein	Ecoli K-12	136.925+/-1.853	Molecules/cell	Medium: Temperature (°C): Doubling time (min): Growth Rate(min): * Growth phase: other: *		Single Molecule Fluorescence	PMID:20671182
mRNA	Ecoli K-12	0.21494+/-0.01164	Molecules/cell	Medium: Temperature (°C): Doubling time (min): Growth Rate(min): * Growth phase: other: *		by FISH	PMID:20671182
mRNA	Ecoli K-12	0.287586207	Molecules/cell	Medium: Temperature (°C): Doubling time (min): Growth Rate(min): * Growth phase: other: *		by RNA_Seq	PMID:20671182
Protein	E. coli K-12 MG1655	8703	molecules/cell/generation	Medium: MOPS Complete Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	2531	molecules/cell/generation	Medium: MOPS Minimal Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	3199	molecules/cell/generation	Medium: MOPS Complete without Methionine Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
edit table

Notes

Transcription and Transcriptional Regulation

[back to top]

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)
pyrH
edit table

Figure courtesy of RegulonDB

</protect>

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]

<protect><gbrowseImage> name=NC_000913:191835..191875 source=MG1655 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

</protect>

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]

<protect> Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name	Mutation	Phenotype	Reference
edit table

Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type	Reference	Notes
microarray	GEO Profiles:b0171 (EcoliWiki Page)	NCBI GEO profiles for pyrH
microarray	GenExpDB:b0171 (EcoliWiki Page)	Summary of data for pyrH from multiple microarray studies
edit table

Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name	Resource Type	Description	Source	Notes
	GFP Fusion	Intergenic region (191637..191903) fused to gfpmut2.	OpenBioSystems	GFP fusion described in Zaslaver, et al. Plate:109-AZ06; Well:F5^[7]
edit table

Notes

Accessions Related to pyrH Expression

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG11539	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB1501	Escherichia coli str. K-12 substr. MG1655
EcoliGenExpDB (EcoliWiki Page)	EcoliGenExpDB:b0171
EcoGene	EcoGene:EG11539	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120001493	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0000582	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Evolution

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]

See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism	Homologs (Statistics)	Comments
Arabidopsis thaliana	AT3G18680 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Oryza gramene	Q5JJV9 (score: 1.000; bootstrap: 100%) Q7XLY5 (score: 0.112)	From Inparanoid:20070104
Xenopus tropicalis	ENSXETP00000006030 (score: 1.000; bootstrap: 78%)	From Inparanoid:20070104
Shigella flexneri	PYRH	From SHIGELLACYC
E. coli O157	PYRH	From ECOO157CYC
edit table

Do-It-Yourself Web Tools

Notes

Families

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
Pfam (EcoliWiki Page)	PF00696 Amino acid kinase family
Superfamily (EcoliWiki Page)	SUPERFAMILY:53633
Panther (EcoliWiki Page)	PTHR26059:SF1
EcoCyc	EcoCyc:EG11539	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG11539	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120001493	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB1501	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0000582	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

References

[back to top]

See Help:References for how to manage references in EcoliWiki.

↑ ^1.00 ^1.01 ^1.02 ^1.03 ^1.04 ^1.05 ^1.06 ^1.07 ^1.08 ^1.09 ^1.10 ^1.11 ^1.12 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
↑ ^2.00 ^2.01 ^2.02 ^2.03 ^2.04 ^2.05 ^2.06 ^2.07 ^2.08 ^2.09 ^2.10 ^2.11 ^2.12 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^3.0 ^3.1 ^3.2 ^3.3 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^4.0 ^4.1 ^4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
↑ ^5.0 ^5.1 CGSC: The Coli Genetics Stock Center
↑ ^6.0 ^6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
↑ Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed

pyrH:On One Page

Quickview

Notes

Gene

Nomenclature

Notes

Location(s) and DNA Sequence

Notes

Sequence Features

Notes

Alleles and Phenotypes

Notes

Genetic Interactions

Notes

Genetic Resources

Notes

Accessions in Other Databases

Notes

Links

Product(s)

Nomenclature

Notes

Function

Notes

Localization

Notes

Structure and Physical Properties

Structure figures

Notes

Gene Product Resources

Notes

Accessions in Other Databases

Notes

Links

Expression

Overview

Cellular Levels

Notes

Transcription and Transcriptional Regulation

Notes

Translation and Regulation of Translation

Notes

Turnover and Regulation of Turnover

Notes

Experimental

Notes

Accessions Related to pyrH Expression

Notes

Links

Evolution

Homologs in Other Organisms

Do-It-Yourself Web Tools

Notes

Families

Notes

Links

References

Categories

Navigation menu

Search