{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

On One Page

Quickview |

Gene |

Product(s) |

Expression|

Evolution |

References |

Quickview

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Standard Name	pmrD
Gene Synonym(s)	ECK2253, b2259, JW2254^[1], JW2254
Product Desc.	polymyxin B resistance protein^[2]^[3] Inactive two-component system connector protein homolog; Salmonella ortholog blocks dephosphorylation of PmrA(BasR) by PmrB(BasS)^[4]
Product Synonyms(s)	polymyxin resistance protein B^[1], B2259^[2]^[1], PmrD^[2]^[1] , ECK2253, JW2254, b2259
Function from GO	<GO_nr />
Knock-Out Phenotype
Regulation/Expression	transcription unit(s): pmrD^[2]
Regulation/Activity
Quick Links
edit table

</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>

Notes

[back to top]

In Salmonella but not E. coli, low Mg(2+) PhoP-activated PmrD controls PmrA(BasR)/PmrB(BasS) activity post-translationally by binding to phospho-PmrA(BasR) and inhibiting its dephosphorylation but not its phosphotransfer, connecting the PhoPQ and PmrAB two-component systems and allowing for an amplified and persistent PmrAB response (Kato, 2007). E. coli pmrD is induced by low Mg(2+) in a PhoP-dependent manner, thus the E. coli prmD product itself is non-functional, as shown by the fact that replacing the E. coli chromosomal prmD with the Salmonella prmD confers the Salmonella low Mg(2+) response to E. coli (Winfield, 2004). Although PmrA represses pmrD transcription in Salmonella, pmrD is not regulated by pmrA in E. coli (Winfield, 2004). A Salmonella prmD mutation eliminates the polymyxin B resistance induced in low Mg(2+), and this defect is corrected by a complementing Salmonella prmD+ clone (Kox, 2000); prmD+ E. coli K-12 does not show low Mg(+2)-induced polymyxin B resistance at all (Kato, 2007). However, citing their unpublished results, Kox (2000) report that E. coli K-12 prmD can fully rescue the Salmonella prmD defect, and they conclude that prmD is function. Although this experimental result is not refuted, repeated or discussed in Kato (2007), it seems as if this unpublished observation has been retracted. PhoPQ regulon.^[4]

Gene

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css> <protect>

Nomenclature

[back to top]

See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name	pmrD
Mnemonic	Polymyxin B resistance
Synonyms	ECK2253, b2259, JW2254^[1], JW2254
edit table

</protect>

Notes

Location(s) and DNA Sequence

[back to top]

<protect> See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain	Map location	Genome coordinates	Genome browsers	Sequence links
MG1655	51.11 minutes	MG1655: 2371560..2371294 <gbrowseImage> name=NC_000913:2371294..2371560 source=MG1655 preset=GeneLocation </gbrowseImage>	EcoCyc GBrowse(MG1655)	FASTA Dump EcoCyc Sequence Dump
REL606		NC_012967: 2320051..2319785 <gbrowseImage> name=NC_012967:2319785..2320051 source=REL606 preset=GeneLocation </gbrowseImage>	GBrowse (REL606)	FASTA Dump
BW2952		NC_012759: 2257099..2257365 <gbrowseImage> name=NC_012759:2257099..2257365 source=BW2952 preset=GeneLocation </gbrowseImage>	GBrowse (BW2952)	FASTA Dump
W3110		W3110: 2378208..2377942 <gbrowseImage> name=NC_007779:2377942..2378208 source=W3110 preset=GeneLocation </gbrowseImage>	GBrowse(W3110)	FASTA Dump
DH10B		DH10B: 2462548..2462282 <gbrowseImage> name=NC_010473:2462282..2462548 source=DH10B preset=GeneLocation </gbrowseImage>	GBrowse(DH10B)	FASTA Dump
edit table

</protect>

Notes

Sequence Features

[back to top]

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type	Strain	Genomic Location	Evidence	Reference	Notes
edit table

Notes

Alleles and Phenotypes

[back to top]

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele	Nt change(s)	AA change(s)	Phenotype: Description	Reference	Availability	Comments
ΔpmrD (Keio:JW2254)	deletion	deletion		PMID:16738554	Shigen CGSC9817^[5]
pmrDL19I		L19I	(in strain: ECOR 23, ECOR 32, ECOR 38, ECOR 39, ECOR 40, ECOR 41, ECOR 51, ECOR 52, ECOR 54, ECOR 55, ECOR 56, ECOR 57, ECOR 61, ECOR 62, ECOR 63, ECOR 64, ECOR 65 and ECOR 66)			Strain variation; seeded from UniProt:P37590
pmrDM20K		M20K	(in strain: ECOR 46, ECOR 49 and O2:HN / ECOR 50 / P97 / UPEC)			Strain variation; seeded from UniProt:P37590
pmrDV83A		V83A	(in strain: ECOR 27, ECOR 33, ECOR 38, ECOR 39, ECOR 41, ECOR 44, ECOR 45, ECOR 47, ECOR 51, ECOR 52, ECOR 53, ECOR 54, ECOR 55, ECOR 56, ECOR 57, ECOR 59, ECOR 60, ECOR 61, ECOR 63, ECOR 64, ECOR 65, ECOR 66 and ECOR 69)			Strain variation; seeded from UniProt:P37590
pmrDA84E		A84E	(in strain: ECOR 28 and ECOR 30)			Strain variation; seeded from UniProt:P37590
pmrDA27T		A27T	(in strain: ECOR 46, ECOR 48, ECOR 49 and O2:HN / ECOR 50 / P97 / UPEC)			Strain variation; seeded from UniProt:P37590
pmrDS71C		S71C	(in strain: ECOR 38, ECOR 39, ECOR 41, ECOR 51, ECOR 52, ECOR 53, ECOR 54, ECOR 55, ECOR 56, ECOR 61, ECOR 63, ECOR 64, ECOR 65 and ECOR 66)			Strain variation; seeded from UniProt:P37590
pmrDC81S		C81S	(in strain: ECOR 53, ECOR 59 and ECOR 60)			Strain variation; seeded from UniProt:P37590
pmrDK82T		K82T	(in strain: ECOR 26, ECOR 27, ECOR 29, ECOR 30, ECOR 33, ECOR 44, ECOR 45, ECOR 47, ECOR 58, ECOR 67, ECOR 68, ECOR 69 and ECOR 71)			Strain variation; seeded from UniProt:P37590
pmrDN11D		N11D	(in strain: ECOR 46, ECOR 48, ECOR 49 and O2:HN / ECOR 50 / P97 / UPEC)			Strain variation; seeded from UniProt:P37590
pmrDD14N		D14N	(in strain: ECOR 53, ECOR 59 and ECOR 60)			Strain variation; seeded from UniProt:P37590
ΔpmrD-741::kan				PMID:16738554	CGSC:102384
edit table

Notes

Genetic Interactions

[back to top]

Interactor	Interaction	Allele	Score(s)	Reference(s)	Accessions	Notes
edit table

</protect>

Notes

Genetic Resources

[back to top]

See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource	Resource Type	Source	Notes/Reference
JW2254	Plasmid clone	Shigen	PMID:16769691 Status:Clone OK Primer 1:GCCGAATGGCTGGTCAAAAAATC Primer 2:CCtTGAGTTTTCCCTGCCACTTT
4B4	Kohara Phage	Genobase	PMID:3038334
5H12	Kohara Phage	Genobase	PMID:3038334
zfa-723::Tn10	Linked marker	CAG12178 gyrA+ = CGSC7526^[5]	est. P1 cotransduction: 34% ^[6] Synonyms:zei-723::Tn10, zfa-723::Tn10 nnnThe original CAG12178 was NalR. This is a NalS derivative constructed by S. McAteer (CGSC).
zfb-223::Tn10	Linked marker	CAG18484 = CGSC7406^[5]	est. P1 cotransduction: 52% ^[6] Synonyms:zej-223::Tn10
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:G7172	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG12671	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120003748	Escherichia coli str. K-12 substr. MG1655
NCBI (EcoliWiki Page)	GeneID:945130	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB2537	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0007468	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Product(s)

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name	PmrD
Synonyms	polymyxin resistance protein B^[1], B2259^[2]^[1], PmrD^[2]^[1] , ECK2253, JW2254, b2259
Product description	polymyxin B resistance protein^[2]^[3] Inactive two-component system connector protein homolog; Salmonella ortholog blocks dephosphorylation of PmrA(BasR) by PmrB(BasS)^[4]
EC number (for enzymes)
edit table

Notes

Function

[back to top]

<protect> Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier	GO ID	GO term name	Reference	Evidence Code	with/from	Aspect	Notes	Status
	GO:0046677	response to antibiotic	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0046	P	Seeded from EcoCyc (v14.0)	complete
edit table

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type	Partner	References	Evidence
Protein	otsB	PMID:16606699	Experiment(s):EBI-1142354
Protein	yahO	PMID:16606699	Experiment(s):EBI-1142354
Protein	yedN	PMID:16606699	Experiment(s):EBI-1142354
Protein	rpsI	PMID:16606699	Experiment(s):EBI-1142354
Protein	rpsS	PMID:16606699	Experiment(s):EBI-1142354
Protein	pepD	PMID:16606699	Experiment(s):EBI-1142354
Protein	rplQ	PMID:16606699	Experiment(s):EBI-1142354
Protein	rplB	PMID:16606699	Experiment(s):EBI-1142354
edit table

</protect>

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment	Description	Evidence	Reference/Source	Notes
edit table

Notes

Structure and Physical Properties

[back to top]

<protect> Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence	at EcoCyc MKTLSKQDNA MEWLVKKSCC NKQDNRHVLM LCDAGGAIKM IAEVKSDFAV KVGDLLSPLQ NALYCINREK LHTVKVLSAS SYSPDEWERQ CKVAGKTQ
Length	98
Mol. Wt	10.987 kDa
pI	8.7 (calculated)
Extinction coefficient	13,980 - 14,605 (calc based on 2 Y, 2 W, and 5 C residues)
edit table

Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type	Residues	Description	Notes	References
Domain	1..82	PF11183 Polymyxin resistance protein PmrD		PMID:19920124
edit table

<motif_map/>

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=pmrD taxon=562,83333 </beststructure>

Models

View models at:

edit table

</protect>

Structure figures

</protect>

Notes

Gene Product Resources

[back to top]

See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type	Source	Notes/Reference
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
NCBI (Protein) (EcoliWiki Page)	GI:90111410	Escherichia coli str. K-12 substr. MG1655
NCBI (Protein) (EcoliWiki Page)	GeneID:945130	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0007468	Escherichia coli str. K-12 substr. MG1655
UniProt (EcoliWiki Page)	UniProtKB/Swiss-Prot:P37590	Escherichia coli str. K-12 substr. MG1655
EcoCyc	EcoCyc:G7172	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG12671	Escherichia coli str. K-12 substr. MG1655
NCBI (Gene) (EcoliWiki Page)	GeneID:945130	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120003748	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB2537	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Expression

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Cellular Levels

[back to top]

See Help:Cellular levels

Molecule	Organism or Strain	Value	Units	Experimental Conditions	Assay used	Reference(s)
Protein	E. coli K-12 MG1655	258	molecules/cell/generation	Medium: MOPS Complete Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	PMID: 24766808
Protein	E. coli K-12 MG1655	147	molecules/cell/generation	Medium: MOPS Minimal Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	PMID: 24766808
Protein	E. coli K-12 MG1655	594	molecules/cell/generation	Medium: MOPS Complete without Methionine Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	PMID: 24766808
edit table

Notes

Transcription and Transcriptional Regulation

[back to top]

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)
pmrD
edit table

Figure courtesy of RegulonDB

</protect>

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]

<protect><gbrowseImage> name=NC_000913:2371540..2371580 source=MG1655 flip=1 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

</protect>

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]

<protect> Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name	Mutation	Phenotype	Reference
edit table

Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type	Reference	Notes
microarray	GEO Profiles:b2259 (EcoliWiki Page)	NCBI GEO profiles for pmrD
microarray	GenExpDB:b2259 (EcoliWiki Page)	Summary of data for pmrD from multiple microarray studies
edit table

Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name	Resource Type	Description	Source	Notes
	GFP Fusion	Intergenic region (2371518..2371718) fused to gfpmut2.	OpenBioSystems	GFP fusion described in Zaslaver, et al. Plate:109-AZ13; Well:E11^[7]
edit table

Notes

Accessions Related to pmrD Expression

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:G7172	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB2537	Escherichia coli str. K-12 substr. MG1655
EcoliGenExpDB (EcoliWiki Page)	EcoliGenExpDB:b2259
EcoGene	EcoGene:EG12671	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120003748	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0007468	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Evolution

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]

Do-It-Yourself Web Tools

Notes

Families

[back to top]

See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism	Homologs (Statistics)	Comments
E. coli O157	PMRD	From ECOO157CYC
edit table

Notes

Families

[back to top]

<protect> See Help:Evolution_families for help entering or editing information in this section of EcoliWiki.

Database	Accession	Notes
Pfam (EcoliWiki Page)	PF11183 Polymyxin resistance protein PmrD
edit table

</protect> <protect></protect>

Notes

Links

[back to top]

Name	URL	Comments
edit table

References

[back to top]

See Help:References for how to manage references in EcoliWiki.

↑ ^1.0 ^1.1 ^1.2 ^1.3 ^1.4 ^1.5 ^1.6 ^1.7 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
↑ ^2.0 ^2.1 ^2.2 ^2.3 ^2.4 ^2.5 ^2.6 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^3.0 ^3.1 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^4.0 ^4.1 ^4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
↑ ^5.0 ^5.1 ^5.2 CGSC: The Coli Genetics Stock Center
↑ ^6.0 ^6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
↑ Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed

pmrD:On One Page

Quickview

Notes

Gene

Nomenclature

Notes

Location(s) and DNA Sequence

Notes

Sequence Features

Notes

Alleles and Phenotypes

Notes

Genetic Interactions

Notes

Genetic Resources

Notes

Accessions in Other Databases

Notes

Links

Product(s)

Nomenclature

Notes

Function

Notes

Localization

Notes

Structure and Physical Properties

Structure figures

Notes

Gene Product Resources

Notes

Accessions in Other Databases

Notes

Links

Expression

Overview

Cellular Levels

Notes

Transcription and Transcriptional Regulation

Notes

Translation and Regulation of Translation

Notes

Turnover and Regulation of Turnover

Notes

Experimental

Notes

Accessions Related to pmrD Expression

Notes

Links

Evolution

Homologs in Other Organisms

Do-It-Yourself Web Tools

Notes

Families

Notes

Families

Notes

Links

References

Categories

Navigation menu

Search