pmrD:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
pmrD |
|---|---|
| Mnemonic |
Polymyxin B resistance |
| Synonyms |
ECK2253, b2259, JW2254[1], JW2254 |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
51.11 minutes |
MG1655: 2371560..2371294 |
||
|
NC_012967: 2320051..2319785 |
||||
|
NC_012759: 2257099..2257365 |
||||
|
W3110 |
|
W3110: 2378208..2377942 |
||
|
DH10B: 2462548..2462282 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔpmrD (Keio:JW2254) |
deletion |
deletion |
|||||
|
pmrDL19I |
L19I |
(in strain: ECOR 23, ECOR 32, ECOR 38, ECOR 39, ECOR 40, ECOR 41, ECOR 51, ECOR 52, ECOR 54, ECOR 55, ECOR 56, ECOR 57, ECOR 61, ECOR 62, ECOR 63, ECOR 64, ECOR 65 and ECOR 66) |
Strain variation; seeded from UniProt:P37590 | ||||
|
pmrDM20K |
M20K |
(in strain: ECOR 46, ECOR 49 and O2:HN / ECOR 50 / P97 / UPEC) |
Strain variation; seeded from UniProt:P37590 | ||||
|
pmrDV83A |
V83A |
(in strain: ECOR 27, ECOR 33, ECOR 38, ECOR 39, ECOR 41, ECOR 44, ECOR 45, ECOR 47, ECOR 51, ECOR 52, ECOR 53, ECOR 54, ECOR 55, ECOR 56, ECOR 57, ECOR 59, ECOR 60, ECOR 61, ECOR 63, ECOR 64, ECOR 65, ECOR 66 and ECOR 69) |
Strain variation; seeded from UniProt:P37590 | ||||
|
pmrDA84E |
A84E |
(in strain: ECOR 28 and ECOR 30) |
Strain variation; seeded from UniProt:P37590 | ||||
|
pmrDA27T |
A27T |
(in strain: ECOR 46, ECOR 48, ECOR 49 and O2:HN / ECOR 50 / P97 / UPEC) |
Strain variation; seeded from UniProt:P37590 | ||||
|
pmrDS71C |
S71C |
(in strain: ECOR 38, ECOR 39, ECOR 41, ECOR 51, ECOR 52, ECOR 53, ECOR 54, ECOR 55, ECOR 56, ECOR 61, ECOR 63, ECOR 64, ECOR 65 and ECOR 66) |
Strain variation; seeded from UniProt:P37590 | ||||
|
pmrDC81S |
C81S |
(in strain: ECOR 53, ECOR 59 and ECOR 60) |
Strain variation; seeded from UniProt:P37590 | ||||
|
pmrDK82T |
K82T |
(in strain: ECOR 26, ECOR 27, ECOR 29, ECOR 30, ECOR 33, ECOR 44, ECOR 45, ECOR 47, ECOR 58, ECOR 67, ECOR 68, ECOR 69 and ECOR 71) |
Strain variation; seeded from UniProt:P37590 | ||||
|
pmrDN11D |
N11D |
(in strain: ECOR 46, ECOR 48, ECOR 49 and O2:HN / ECOR 50 / P97 / UPEC) |
Strain variation; seeded from UniProt:P37590 | ||||
|
pmrDD14N |
D14N |
(in strain: ECOR 53, ECOR 59 and ECOR 60) |
Strain variation; seeded from UniProt:P37590 | ||||
|
ΔpmrD-741::kan |
| ||||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW2254 |
Plasmid clone |
Status:Clone OK Primer 1:GCCGAATGGCTGGTCAAAAAATC Primer 2:CCtTGAGTTTTCCCTGCCACTTT | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 34% [6] | ||
|
Linked marker |
est. P1 cotransduction: 52% [6] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 3.0 3.1 3.2 CGSC: The Coli Genetics Stock Center
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 5.0 5.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
