pflA:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Standard Name |
pflA |
---|---|
Gene Synonym(s) |
ECK0893, b0902, JW0885, act[1], act |
Product Desc. |
Pyruvate formate lyase I activase[2] |
Product Synonyms(s) |
pyruvate formate lyase activating enzyme 1[1], B0902[3][1], Act[3][1], PflA[3][1] , act, ECK0893, JW0885, b0902 |
Function from GO |
<GO_nr /> |
Knock-Out Phenotype | |
Regulation/Expression | |
Regulation/Activity | |
Quick Links | |
edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
Radical SAM superfamily.[2]
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Standard name |
pflA |
---|---|
Mnemonic |
Pyruvate formate lyase |
Synonyms |
ECK0893, b0902, JW0885, act[1], act |
edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
---|---|---|---|---|
MG1655 |
20.47 minutes |
MG1655: 950303..949563 |
||
NC_012967: 968173..967433 |
||||
NC_012759: 852531..853271 |
||||
W3110 |
|
W3110: 951502..950762 |
||
DH10B: 1004231..1003491 |
||||
edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
---|---|---|---|---|---|
Coding Start (SO:0000323) |
949566 |
Edman degradation |
PMID:3053170 |
| |
edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
---|---|---|---|---|---|---|---|
ΔpflA (Keio:JW0885) |
deletion |
deletion |
PMID:16738554 |
||||
ΔpflA::kan |
deletion |
Biolog:respiration |
unable to respire Acetate |
PMID:16095938 |
|||
ΔpflA726::kan |
PMID:16738554 |
| |||||
edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
---|---|---|---|---|---|---|
edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
Resource | Resource Type | Source | Notes/Reference |
---|---|---|---|
JW0885 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCTCAGTTATTGGTCGCATTCA Primer 2:CCGAACATTACCTTATGACCGTA | |
Kohara Phage |
PMID:3038334 | ||
zca-1230::Tn10 |
Linked marker |
est. P1 cotransduction: 90% [5] | |
Linked marker |
est. P1 cotransduction: 8% [5] | ||
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG10028 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10028 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120000025 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EchoBASE:EB0027 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0003068 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
Standard name |
PflA |
---|---|
Synonyms |
pyruvate formate lyase activating enzyme 1[1], B0902[3][1], Act[3][1], PflA[3][1] , act, ECK0893, JW0885, b0902 |
Product description |
Pyruvate formate lyase I activase[2] |
EC number (for enzymes) | |
edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
---|---|---|---|---|---|---|---|---|
GO:0003824 |
catalytic activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR007197 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005506 |
iron ion binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0408 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005737 |
cytoplasm |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0963 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005737 |
cytoplasm |
GO_REF:0000023 |
IEA: Inferred from Electronic Annotation |
SP_SL:SL-0086 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005975 |
carbohydrate metabolic process |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0119 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006006 |
glucose metabolic process |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0313 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006800 |
oxygen and reactive oxygen species metabolic process |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR001989 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016491 |
oxidoreductase activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR001989 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016491 |
oxidoreductase activity |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0560 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0043365 |
(formate-C-acetyltransferase)-activating enzyme activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR012838 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0043365 |
(formate-C-acetyltransferase)-activating enzyme activity |
GOA:spec |
IEA: Inferred from Electronic Annotation |
EC:1.97.1.4 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0046872 |
metal ion binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0479 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0051536 |
iron-sulfur cluster binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR007197 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0051536 |
iron-sulfur cluster binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0411 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0051539 |
4 iron, 4 sulfur cluster binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR001989 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0051539 |
4 iron, 4 sulfur cluster binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0004 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0055114 |
oxidation reduction |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR001989 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0055114 |
oxidation reduction |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR012838 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0055114 |
oxidation reduction |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0560 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006974 |
response to DNA damage stimulus |
PMID:11967071 |
IEP: Inferred from Expression Pattern |
P |
complete | |||
GO:0016491 |
oxidoreductase activity |
PMID:19711960 |
IDA: Inferred from Direct Assay |
F |
Fig. 2 illustrates that the over-expression of PflA allows for greater use of iron-sulfur clusters in anaerobic environments. |
complete | ||
edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
Partner Type | Partner | Notes | References | Evidence |
---|---|---|---|---|
Protein |
matC |
PMID:16606699 |
Experiment(s):EBI-1138307 | |
Protein |
nadE |
PMID:16606699 |
Experiment(s):EBI-1138307 | |
edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
Compartment | Description | Evidence | Reference/Source | Notes |
---|---|---|---|---|
edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
Name | |
---|---|
Sequence |
MSVIGRIHSF ESCGTVDGPG IRFITFFQGC LMRCLYCHNR DTWDTHGGKE VTVEDLMKEV VTYRHFMNAS GGGVTASGGE AILQAEFVRD WFRACKKEGI HTCLDTNGFV RRYDPVIDEL LEVTDLVMLD LKQMNDEIHQ NLVGVSNHRT LEFAKYLANK NVKVWIRYVV VPGWSDDDDS AHRLGEFTRD MGNVEKIELL PYHELGKHKW VAMGEEYKLD GVKPPKKETM ERVKGILEQY GHKVMF |
Length |
246 |
Mol. Wt |
28.203 kDa |
pI |
6.4 (calculated) |
Extinction coefficient |
39,420 - 40,170 (calc based on 8 Y, 5 W, and 6 C residues) |
edit table |
Domains/Motifs/Modification Sites
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
Resource type | Source | Notes/Reference |
---|---|---|
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
ASAP:ABE-0003068 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EcoCyc:EG10028 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10028 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
RegulonDB:ECK120000025 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB0027 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
---|---|---|---|---|---|---|---|
Protein |
E. coli K-12 MG1655 |
2129 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
527 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
697 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
![]() Figure courtesy of RegulonDB |
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:950283..950323
source=MG1655
flip=1
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
Allele Name | Mutation | Phenotype | Reference |
---|---|---|---|
edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
Type | Reference | Notes |
---|---|---|
microarray |
NCBI GEO profiles for pflA | |
microarray |
Summary of data for pflA from multiple microarray studies | |
edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
Resource Name | Resource Type | Description | Source | Notes |
---|---|---|---|---|
GFP Fusion |
Intergenic region (950214..950527) fused to gfpmut2. |
GFP fusion described in Zaslaver, et al. | ||
edit table |
<protect></protect>
Notes
Accessions Related to pflA Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG10028 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB0027 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10028 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120000025 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0003068 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
Organism | Homologs (Statistics) | Comments |
---|---|---|
Shigella flexneri |
PFLA |
From SHIGELLACYC |
E. coli O157 |
PFLA |
From ECOO157CYC |
edit table |
Do-It-Yourself Web Tools
<protect></protect>
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG10028 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10028 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120000025 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB0027 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0003068 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 2.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 3.0 3.1 3.2 3.3 3.4 3.5 3.6 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
- ↑ 5.0 5.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed
Categories