nuoJ:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
| Standard Name |
nuoJ |
|---|---|
| Gene Synonym(s) |
ECK2274, b2280, JW2275[1], JW2275 |
| Product Desc. |
Component of NADH dehydrogenase I[2][3] NADH:ubiquinone oxidoreductase subunit J, complex I; NADH dehydrogenase I[4] |
| Product Synonyms(s) |
NADH:ubiquinone oxidoreductase, membrane subunit J[1], B2280[2][1], NuoJ[2][1] , ECK2274, JW2275, b2280 |
| Function from GO |
<GO_nr /> |
| Knock-Out Phenotype | |
| Regulation/Expression |
transcription unit(s): nuoABCEFGHIJKLMN[2], nuo1-14 |
| Regulation/Activity | |
| Quick Links | |
| edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
nuoJ |
|---|---|
| Mnemonic |
NADH:ubiquinone oxidoreductase |
| Synonyms |
ECK2274, b2280, JW2275[1], JW2275 |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
51.58 minutes |
MG1655: 2393918..2393364 |
||
|
NC_012967: 2339487..2338933 |
||||
|
NC_012759: 2279169..2279723 |
||||
|
W3110 |
|
W3110: 2400566..2400012 |
||
|
DH10B: 2485683..2485129 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
nuoJ(del) (Keio:JW2275) |
deletion |
deletion |
PMID:16738554 |
||||
|
nuoJ::Tn5KAN-2 (FB20736) |
Insertion at nt 397 in Plus orientation |
PMID:15262929 |
contains pKD46 | ||||
|
nuoJ::Tn5KAN-2 (FB20737) |
Insertion at nt 397 in Plus orientation |
PMID:15262929 |
does not contain pKD46 | ||||
|
nuoJ(del)::kan |
deletion |
Biolog:respiration |
unable to respire b-Methyl-D-glucoside |
PMID:16095938 |
|||
|
nuoJ(del)::kan |
deletion |
Biolog:respiration |
unable to respire a-D-Glucose-6-phosphate |
PMID:16095938 |
|||
|
nuoJ(del)::kan |
deletion |
Biolog:respiration |
unable to respire D-Galacturonate |
PMID:16095938 |
|||
|
nuoJ(del)::kan |
deletion |
Biolog:respiration |
unable to respire Acetate |
PMID:16095938 |
|||
|
nuoJ(del)::kan |
deletion |
Biolog:respiration |
unable to respire a-Hydroxybutyrate |
PMID:16095938 |
|||
|
nuoJ(del)::kan |
deletion |
Biolog:respiration |
unable to respire a-Ketobutyrate |
PMID:16095938 |
|||
|
nuoJ(del)::kan |
deletion |
Biolog:respiration |
unable to respire a-Ketoglutarate |
PMID:16095938 |
|||
|
nuoJ(del)::kan |
deletion |
Biolog:respiration |
unable to respire Succinate |
PMID:16095938 |
|||
|
nuoJ(del)::kan |
deletion |
Biolog:respiration |
unable to respire Bromosuccinate |
PMID:16095938 |
|||
|
nuoJ(del)::kan |
deletion |
Biolog:respiration |
unable to respire Glucuronamide |
PMID:16095938 |
|||
|
nuoJ(del)::kan |
deletion |
Biolog:respiration |
unable to respire L-Alanine |
PMID:16095938 |
|||
|
nuoJ(del)::kan |
deletion |
Biolog:respiration |
unable to respire L-Alanyl-glycine |
PMID:16095938 |
|||
|
nuoJ(del)::kan |
deletion |
Biolog:respiration |
unable to respire L-Asparagine |
PMID:16095938 |
|||
|
nuoJ(del)::kan |
deletion |
Biolog:respiration |
unable to respire L-Aspartate |
PMID:16095938 |
|||
|
nuoJ(del)::kan |
deletion |
Biolog:respiration |
unable to respire Glycyl-L-aspartate |
PMID:16095938 |
|||
|
nuoJ(del)::kan |
deletion |
Biolog:respiration |
unable to respire L-Serine |
PMID:16095938 |
|||
|
nuoJ(del)::kan |
deletion |
Biolog:respiration |
unable to respire Uridine |
PMID:16095938 |
|||
|
nuoJ762(del)::kan |
PMID:16738554 |
||||||
|
nuoJ762(del)::FRT |
deletion |
Mutagenesis rate |
Decrease in stress induced mutagenesis. |
PMID:23224554 |
Parent Strain: SMR4562 Experimental Strain: SMR13652 |
The mutation caused by the deletion of the nuoJ gene was strong as there was a decrease of SIM by 90 percent of wild type. | |
|
nuoJ762(del)::FRT |
deletion |
Sensitivity to |
Increased SDS-EDTA sensitivity |
PMID:23224554 |
Parent Strain: SMR4562 Experimental Strain: SMR13652 |
The mutation conferred increase sensitivity toward SDS-EDTA. See table S7 and S1 for summarized results. | |
|
SMR4562 yiaG-yfp FRTcatFRT nuoJ762(del)::FRTKanFRT |
deletion |
SigmaS activity |
Decrease in Sigma E activity |
PMID:23224554 |
Parental Strain: SMR10582 Experimental Strain: SMR14289 |
See table S8 for full experimental data. | |
|
CAG45114 nuoJ762(del)::FRTKanFRT |
Deletion |
SigmaE activity |
Decrease in sigmaE activity |
PMID:23224554 |
Parental Strain: CAG45114 Experimental Strain: SMR15358 |
See table S11 for experimental data. | |
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW2275 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCGAGTTCGCTTTTTATATCTG Primer 2:CCTGCGTGCTCCTCCGTTTTTCT | |
|
Kohara Phage |
PMID:3038334 | ||
|
Kohara Phage |
PMID:3038334 | ||
|
Linked marker |
est. P1 cotransduction: 88% [6] | ||
|
zfd-1::Tn10 |
Linked marker |
est. P1 cotransduction: % [6] | |
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG12090 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG12090 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120001995 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EchoBASE:EB2014 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0007536 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
| Standard name |
NuoJ |
|---|---|
| Synonyms |
NADH:ubiquinone oxidoreductase, membrane subunit J[1], B2280[2][1], NuoJ[2][1] , ECK2274, JW2275, b2280 |
| Product description |
Component of NADH dehydrogenase I[2][3] NADH:ubiquinone oxidoreductase subunit J, complex I; NADH dehydrogenase I[4] |
| EC number (for enzymes) |
|
| edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
| Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
|---|---|---|---|---|---|---|---|---|
|
GO:0008137 |
NADH dehydrogenase (ubiquinone) activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR001457 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0048038 |
quinone binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0874 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0005886 |
plasma membrane |
PMID:7607227 |
IDA: Inferred from Direct Assay |
C |
The NADH dehydrogenase I complex fractionates with cytoplasmic membranes. |
complete | ||
|
GO:0055114 |
oxidation reduction |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR001457 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
Contributes to |
GO:0003954 |
NADH dehydrogenase activity |
PMID:3122832 |
IDA: Inferred from Direct Assay |
F |
Purified NADH dehydrogenase I in membrane vesicles can oxidize NADH. |
complete | |
|
GO:0030964 |
NADH dehydrogenase complex |
PMID:7607227 |
IDA: Inferred from Direct Assay |
C |
E. coli NADH dehydrogenase I was purified and the subunits separated by SDS-PAGE. These seven subunits were not recovered from the gel in sufficient amounts to allow Edman degradation. The polypeptides were assigned to their respective genes based on their apparent molecular masses. |
complete | ||
|
GO:0055114 |
oxidation reduction |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0560 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
| edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
| Partner Type | Partner | Notes | References | Evidence |
|---|---|---|---|---|
|
Protein |
Subunits of NADH dehydrogenase I |
could be indirect |
| |
| edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
| Compartment | Description | Evidence | Reference/Source | Notes |
|---|---|---|---|---|
|
plasma membrane |
C-terminus localized in the cytoplasm with 5 predicted transmembrane domains |
Daley et al. (2005) [7] |
||
|
plasma membrane |
From EcoCyc[3] |
| ||
| edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
| Name | |
|---|---|
| Sequence |
MEFAFYICGL IAILATLRVI THTNPVHALL YLIISLLAIS GVFFSLGAYF AGALEIIVYA GAIMVLFVFV VMMLNLGGSE IEQERQWLKP QVWIGPAILS AIMLVVIVYA ILGVNDQGID GTPISAKAVG ITLFGPYVLA VELASMLLLA GLVVAFHVGR EERAGEVLSN RKDDSAKRKT EEHA |
| Length |
184 |
| Mol. Wt |
19.874 kDa |
| pI |
5.5 (calculated) |
| Extinction coefficient |
19,940 - 20,065 (calc based on 6 Y, 2 W, and 1 C residues) |
| edit table |
Domains/Motifs/Modification Sites
|
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
|
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
| Resource type | Source | Notes/Reference |
|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
ASAP:ABE-0007536 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EcoCyc:EG12090 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG12090 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
RegulonDB:ECK120001995 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB2014 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
| Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
|---|---|---|---|---|---|---|---|
|
Protein |
E. coli K-12 MG1655 |
1336 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
529 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
596 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
| edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
|
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
Figure courtesy of RegulonDB |
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:2393898..2393938
source=MG1655
flip=1
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
| Allele Name | Mutation | Phenotype | Reference |
|---|---|---|---|
| edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
| Type | Reference | Notes |
|---|---|---|
|
microarray |
NCBI GEO profiles for nuoJ | |
|
microarray |
Summary of data for nuoJ from multiple microarray studies | |
| edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
| Resource Name | Resource Type | Description | Source | Notes |
|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions Related to nuoJ Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG12090 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB2014 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG12090 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120001995 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0007536 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
| Organism | Homologs (Statistics) | Comments |
|---|---|---|
|
Dictyostelium discoideum |
|
From Inparanoid:20070104 |
|
Oryza gramene |
|
From Inparanoid:20070104 |
|
Shigella flexneri |
NUOJ |
From SHIGELLACYC |
|
E. coli O157 |
NUOJ |
From ECOO157CYC |
| edit table |
Do-It-Yourself Web Tools
<protect></protect>
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
PF00499 NADH-ubiquinone/plastoquinone oxidoreductase chain 6 |
||
|
EcoCyc:EG12090 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG12090 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120001995 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB2014 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0007536 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 2.2 2.3 2.4 2.5 2.6 2.7 2.8 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 3.2 3.3 3.4 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ Daley, DO et al. (2005) Global topology analysis of the Escherichia coli inner membrane proteome. Science 308 1321-3 PubMed
Categories



