narI:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Standard Name |
narI |
---|---|
Gene Synonym(s) |
ECK1221, b1227, JW1218, chlI[1], chlI |
Product Desc. |
nitrate reductase A, γ subunit[2][3]; Component of nitrate reductase A[2][3] Nitrate reductase I (NRA), gamma subunit[4] |
Product Synonyms(s) |
nitrate reductase 1, gamma (cytochrome b(NR)) subunit[1], B1227[2][1], ChlI[2][1], NarI[2][1] , chlI, ECK1221, JW1218, b1227 |
Function from GO |
<GO_nr /> |
Knock-Out Phenotype | |
Regulation/Expression |
transcription unit(s): narGHJI[2], OP00060, chlC, narG, narGHIJ |
Regulation/Activity | |
Quick Links | |
edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
NarI is involved in localizing NarGHI to the membrane Induced by anaerobiosis plus nitrate.[4]
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Standard name |
narI |
---|---|
Mnemonic |
Nitrate reductase, nitrate regulation |
Synonyms |
ECK1221, b1227, JW1218, chlI[1], chlI |
edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
---|---|---|---|---|
MG1655 |
27.7 minutes |
MG1655: 1285072..1285749 |
||
NC_012967: 1285999..1286676 |
||||
NC_012759: 1173793..1174470 |
||||
W3110 |
|
W3110: 1287426..1288103 |
||
DH10B: 1325313..1325990 |
||||
edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
---|---|---|---|---|---|
Coding Start (SO:0000323) |
1285072 |
Edman degradation |
PMID:3053688 |
| |
edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
---|---|---|---|---|---|---|---|
narI(del) (Keio:JW1218) |
deletion |
deletion |
PMID:16738554 |
||||
narI738(del)::kan |
PMID:16738554 |
||||||
nar-204::Tn10 |
Enzyme Activity |
Mutant is NarI - and has reduced nitrate reductase activity |
PMID:7047497 |
Experimental strain: RK5267 |
table 5 | ||
nar-204::Tn10 |
Enzyme Activity |
Mutant is NarI - and has reduced Formate activity |
PMID:7047497 |
Experimental Strain: RK5267 |
table 5 | ||
edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
---|---|---|---|---|---|---|
edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
Resource | Resource Type | Source | Notes/Reference |
---|---|---|---|
JW1218 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCCAATTCCTGAATATGTTCTT Primer 2:CCGTGACGAGCGCGCACCAGCTG | |
Kohara Phage |
PMID:3038334 | ||
Kohara Phage |
PMID:3038334 | ||
Linked marker |
est. P1 cotransduction: 9% [6] | ||
Linked marker |
est. P1 cotransduction: 51% [6] | ||
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG10640 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10640 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120000633 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EchoBASE:EB0634 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0004125 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
Standard name |
NarI |
---|---|
Synonyms |
nitrate reductase 1, gamma (cytochrome b(NR)) subunit[1], B1227[2][1], ChlI[2][1], NarI[2][1] , chlI, ECK1221, JW1218, b1227 |
Product description |
nitrate reductase A, γ subunit[2][3]; Component of nitrate reductase A[2][3] Nitrate reductase I (NRA), gamma subunit[4] |
EC number (for enzymes) | |
edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
---|---|---|---|---|---|---|---|---|
GO:0005506 |
iron ion binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0408 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005506 |
iron ion binding |
PMID:9325288 |
IPI: Inferred from Physical Interaction |
F |
Seeded from EcoCyc (v14.0) |
Missing: with/from | ||
GO:0005886 |
plasma membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0997 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005886 |
plasma membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-1003 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006810 |
transport |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0813 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0008940 |
nitrate reductase activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR003816 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0008940 |
nitrate reductase activity |
GOA:spec |
IEA: Inferred from Electronic Annotation |
EC:1.7.99.4 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0009055 |
electron carrier activity |
PMID:10504245 |
IPI: Inferred from Physical Interaction |
F |
Seeded from EcoCyc (v14.0) |
Missing: with/from | ||
GO:0009061 |
anaerobic respiration |
PMID:7050087 |
IEP: Inferred from Expression Pattern |
P |
Seeded from EcoCyc (v14.0) |
complete | ||
GO:0009325 |
nitrate reductase complex |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR003816 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016021 |
integral to membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0812 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016021 |
integral to membrane |
GO_REF:0000023 |
IEA: Inferred from Electronic Annotation |
SP_SL:SL-9909 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016491 |
oxidoreductase activity |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0560 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0017004 |
cytochrome complex assembly |
PMID:3053688 |
IDA: Inferred from Direct Assay |
P |
Seeded from EcoCyc (v14.0) |
complete | ||
GO:0022900 |
electron transport chain |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0249 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0031224 |
intrinsic to membrane |
PMID:5996 |
IDA: Inferred from Direct Assay |
C |
Seeded from EcoCyc (v14.0) |
complete | ||
GO:0042128 |
nitrate assimilation |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0534 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0055114 |
oxidation reduction |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR003816 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0055114 |
oxidation reduction |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0560 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
Partner Type | Partner | Notes | References | Evidence |
---|---|---|---|---|
Protein |
Subunits of nitrate reductase A |
could be indirect |
| |
edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
Compartment | Description | Evidence | Reference/Source | Notes |
---|---|---|---|---|
plasma membrane |
C-terminus localized in the cytoplasm with 5 predicted transmembrane domains |
Daley et al. (2005) [7] |
||
plasma membrane |
From EcoCyc[3] |
|||
Inner Membrane |
PMID:3053688 |
| ||
edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
Name | |
---|---|
Sequence |
MQFLNMFFFD IYPYIAGAVF LIGSWLRYDY GQYTWRAASS QMLDRKGMNL ASNLFHIGIL GIFVGHFFGM LTPHWMYEAW LPIEVKQKMA MFAGGASGVL CLIGGVLLLK RRLFSPRVRA TTTGADILIL SLLVIQCALG LLTIPFSAQH MDGSEMMKLV GWAQSVVTFH GGASQHLDGV AFIFRLHLVL GMTLFLLFPF SRLIHIWSVP VEYLTRKYQL VRARH |
Length |
225 |
Mol. Wt |
25.498 kDa |
pI |
10.2 (calculated) |
Extinction coefficient |
44,920 - 45,170 (calc based on 8 Y, 6 W, and 2 C residues) |
edit table |
Domains/Motifs/Modification Sites
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
Resource type | Source | Notes/Reference |
---|---|---|
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
ASAP:ABE-0004125 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EcoCyc:EG10640 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10640 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
RegulonDB:ECK120000633 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB0634 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
---|---|---|---|---|---|---|---|
Protein |
E. coli K-12 MG1655 |
20a |
molecules/cell/generation |
|
Ribosome Profiling |
Low confidence in the sequencing data set. |
PMID: 24766808 |
Protein |
E. coli K-12 MG1655 |
22 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
6a |
molecules/cell/generation |
|
Ribosome Profiling |
Low confidence in the sequencing data set. |
PMID: 24766808 |
edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:1285052..1285092
source=MG1655
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
Allele Name | Mutation | Phenotype | Reference |
---|---|---|---|
edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
Type | Reference | Notes |
---|---|---|
microarray |
NCBI GEO profiles for narI | |
microarray |
Summary of data for narI from multiple microarray studies | |
edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
Resource Name | Resource Type | Description | Source | Notes |
---|---|---|---|---|
edit table |
<protect></protect>
Notes
Accessions Related to narI Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG10640 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB0634 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10640 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120000633 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0004125 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
Organism | Homologs (Statistics) | Comments |
---|---|---|
Shigella flexneri |
NARI |
From SHIGELLACYC |
E. coli O157 |
NARI |
From ECOO157CYC |
edit table |
Do-It-Yourself Web Tools
<protect></protect>
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG10640 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10640 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120000633 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB0634 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0004125 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 3.2 3.3 3.4 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ Daley, DO et al. (2005) Global topology analysis of the Escherichia coli inner membrane proteome. Science 308 1321-3 PubMed
Categories