mukB:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
mukB |
|---|---|
| Mnemonic |
Mukaku (anucleate) |
| Synonyms |
ECK0915, b0924, JW0907[1], JW0907 |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
21.03 minutes |
MG1655: 975549..980009 |
||
|
NC_012967: 993418..997878 |
||||
|
NC_012759: 878517..882977 |
||||
|
W3110 |
|
W3110: 976748..981208 |
||
|
DH10B: 1029477..1033937 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
975549 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Nucleotide sequence of the gene and its putative promoter/ RBS is discussed in reference[3].
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
mukB::Tn5KAN-2 (FB20251) |
Insertion at nt 4399 in Minus orientation |
temperature sensitive |
does not contain pKD46 | ||||
|
mukBM1428L |
M1428L |
No effect |
seeded from UniProt:P22523 | ||||
|
mukBS33F |
S33F |
In mukB106; no effect |
seeded from UniProt:P22523 | ||||
|
mukBQ1429R |
Q1429R |
Abolishes association with mukE and mukF, but still binds DNA |
seeded from UniProt:P22523 | ||||
|
mukBK40L |
K40L |
No effect |
seeded from UniProt:P22523 | ||||
|
mukBD1201N |
D1201N |
In mukB33; no effect |
seeded from UniProt:P22523 | ||||
|
mukBV1381L |
V1381L |
Abolishes DNA-binding, but remains associated with mukE and mukF |
seeded from UniProt:P22523 | ||||
|
mukBL1403P |
L1403P |
Abolishes association with mukE and mukF, but still binds DNA |
seeded from UniProt:P22523 | ||||
|
mukBF1404L |
F1404L |
No effect |
seeded from UniProt:P22523 | ||||
|
mukBD1406N |
D1406N |
No effect |
seeded from UniProt:P22523 | ||||
|
ΔmukB ftsK1::cat |
deletion |
deletion |
Growth Phenotype |
synthetically lethal |
|||
|
ΔmukB:kan |
deletion |
deletion |
Growth Phenotype |
|
| ||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0907 |
Plasmid clone |
Status:Clone OK Primer 1:GCCATTGAACGCGGTAAATTTCG Primer 2:CCACTCGCCTGAGAAGGCGCTTC | |
|
Kohara Phage |
|||
|
zca-1230::Tn10 |
Linked marker |
est. P1 cotransduction: 32% [9] | |
|
Linked marker |
est. P1 cotransduction: 36% [9] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Niki, H et al. (1992) E.coli MukB protein involved in chromosome partition forms a homodimer with a rod-and-hinge structure having DNA binding and ATP/GTP binding activities. EMBO J. 11 5101-9 PubMed
- ↑ 3.0 3.1 Niki, H et al. (1991) The new gene mukB codes for a 177 kd protein with coiled-coil domains involved in chromosome partitioning of E. coli. EMBO J. 10 183-93 PubMed
- ↑ Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed
- ↑ Yu, XC et al. (1998) Role of the C terminus of FtsK in Escherichia coli chromosome segregation. J. Bacteriol. 180 6424-8 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 8.0 8.1 CGSC: The Coli Genetics Stock Center
- ↑ 9.0 9.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
