mqsA:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Standard Name |
mqsA |
---|---|
Gene Synonym(s) |
mqsA, ygiT[1], ECK3012, b3021, mqsA, JW2989[2], JW2989, ygiT |
Product Desc. |
predicted DNA-binding transcriptional regulator[3][4] Antitoxin for MqsR toxin[1] |
Product Synonyms(s) |
predicted DNA-binding transcriptional regulator[2], B3021[3][2], MqsA[3][2] , ECK3012, JW2989, ygiT, b3021 |
Function from GO |
<GO_nr /> |
Knock-Out Phenotype | |
Regulation/Expression | |
Regulation/Activity | |
Quick Links | |
edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
Antitoxin MqsA binds DNA via its helix-turn-helix in its C-terminal domain[1]. Unlike most TA pairs including RelE/RelB, YoeB/YefM and MazF/MazE, the MqsR toxin gene precedes the antitoxin gene in the bicistronic operon[1]. The MqsR/MqsA TA pair is unique in that (i) the antitoxin is larger than the toxin, (ii) both toxin and antitoxin are basic (typically the toxin is basic while the antitoxin is acidic), (iii) the mqsRA sequences are not homologous to any member of a recognized TA system, (iv) the antitoxin binds the toxin at its amino terminus and requires a metal, zinc, for structural stability, (v) the antitoxin is structured throughout its entire sequence, and (vi) the antitoxin binds more than its own promoter (e.g., mqsRA, mcbR, and spy) via its C-terminal domain[1] which implies it regulates more than its own transcription. MqsR cleaves mRNA at GCU sites [5]. Toxin MsqR could be cloned in an ara vector unless antitoxin MqsA is upreguated (Shah, 2006). MqsA is predicted to also be a transcriptional regulator.[6]
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Standard name |
mqsA |
---|---|
Mnemonic |
Motility quorum-sensing |
Synonyms |
mqsA, ygiT[1], ECK3012, b3021, mqsA, JW2989[2], JW2989, ygiT |
edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
---|---|---|---|---|
MG1655 |
68.23 minutes |
MG1655: 3166268..3165873 |
||
NC_012967: 3102418..3102023 |
||||
NC_012759: 3053021..3053416 |
||||
W3110 |
|
W3110: 3166902..3166507 |
||
DH10B: 3264013..3263618 |
||||
edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
---|---|---|---|---|---|
edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
---|---|---|---|---|---|---|---|
edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
---|---|---|---|---|---|---|
edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
Resource | Resource Type | Source | Notes/Reference |
---|---|---|---|
JW2989 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCAAATGTCCGGTTTGCCACCA Primer 2:CCACGGATTTCATTCAATAGTTC | |
Kohara Phage |
PMID:3038334 | ||
Linked marker |
est. P1 cotransduction: 58% [8] | ||
Linked marker |
est. P1 cotransduction: 65% [8] | ||
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
RegulonDB: |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
Standard name |
MqsA |
---|---|
Synonyms |
predicted DNA-binding transcriptional regulator[2], B3021[3][2], MqsA[3][2] , ECK3012, JW2989, ygiT, b3021 |
Product description |
predicted DNA-binding transcriptional regulator[3][4] Antitoxin for MqsR toxin[1] |
EC number (for enzymes) |
|
edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
---|---|---|---|---|---|---|---|---|
GO:0006355 |
regulation of transcription, DNA-dependent |
PMID:19943910 |
IMP: Inferred from Mutant Phenotype |
P |
Seeded from EcoCyc (v14.0) |
complete | ||
GO:0043565 |
sequence-specific DNA binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR001387 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0043565 |
sequence-specific DNA binding |
PMID:19690171 |
IDA: Inferred from Direct Assay |
F |
Seeded from EcoCyc (v14.0) |
complete | ||
edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
Partner Type | Partner | Notes | References | Evidence |
---|---|---|---|---|
Protein |
yfbN |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
gpmM |
PMID:19402753 |
MALDI(Z-score):28.092127 | |
edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
Compartment | Description | Evidence | Reference/Source | Notes |
---|---|---|---|---|
edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
Name | |
---|---|
Sequence |
MKCPVCHQGE MVSGIKDIPY TFRGRKTVLK GIHGLYCVHC EESIMNKEES DAFMAQVKAF RASVNAETVA PEFIVKVRKK LSLTQKEASE IFGGGVNAFS RYEKGNAQPH PSTIKLLRVL DKHPELLNEI R |
Length |
131 |
Mol. Wt |
14.702 kDa |
pI |
9.0 (calculated) |
Extinction coefficient |
4,470 - 4,970 (calc based on 3 Y, W, and 4 C residues) |
edit table |
Domains/Motifs/Modification Sites
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
Resource type | Source | Notes/Reference |
---|---|---|
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
RegulonDB: |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE: |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
---|---|---|---|---|---|---|---|
Protein |
E. coli K-12 MG1655 |
448 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
319 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
323 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:3166248..3166288
source=MG1655
flip=1
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
Allele Name | Mutation | Phenotype | Reference |
---|---|---|---|
edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
Type | Reference | Notes |
---|---|---|
microarray |
NCBI GEO profiles for ygiT | |
microarray |
Summary of data for ygiT from multiple microarray studies | |
edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
Resource Name | Resource Type | Description | Source | Notes |
---|---|---|---|---|
edit table |
<protect></protect>
Notes
Accessions Related to mqsA Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
RegulonDB: |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP: |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
Organism | Homologs (Statistics) | Comments |
---|---|---|
Xenopus tropicalis |
|
From Inparanoid:20070104 |
E. coli O157 |
Z1059 |
From ECOO157CYC |
edit table |
Do-It-Yourself Web Tools
<protect></protect>
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc: |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene: |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB: |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE: |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP: |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.0 1.1 1.2 1.3 1.4 1.5 1.6 Brown, BL et al. (2009) Three dimensional structure of the MqsR:MqsA complex: a novel TA pair comprised of a toxin homologous to RelE and an antitoxin with unique properties. PLoS Pathog. 5 e1000706 PubMed
- ↑ 2.0 2.1 2.2 2.3 2.4 2.5 2.6 2.7 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 3.0 3.1 3.2 3.3 3.4 3.5 3.6 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ Yamaguchi, Y et al. (2009) MqsR, a crucial regulator for quorum sensing and biofilm formation, is a GCU-specific mRNA interferase in Escherichia coli. J. Biol. Chem. 284 28746-53 PubMed
- ↑ EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 7.0 7.1 CGSC: The Coli Genetics Stock Center
- ↑ 8.0 8.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
Categories