mntH:On One Page

From EcoliWiki
Jump to: navigation, search

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Quickview | Gene | Product(s) | Expression| Evolution | References |

Quickview

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

<protect>

Standard Name

mntH

Gene Synonym(s)

ECK2387, b2392, JW2388, mntA, yfeP[1], yfeP

Product Desc.

MntH manganese ion transporter[2][3]

Mn(2+) transporter, role in bacterial response to reactive oxygen species; also transports Fe(2+), Cd(2+) and other divalent metals[4]

Product Synonyms(s)

manganese/divalent cation transporter[1], B2392[2][1], MntA[2][1], MntH[2][1], YfeP[2][1] , ECK2387, JW2388, mntA, yfeP, b2392

Function from GO

<GO_nr />

Knock-Out Phenotype
Regulation/Expression

transcription unit(s): mntH[2]

Regulation/Activity
Quick Links

porteco.png EcoCyc.gif regulondb.jpg

dnadisplay.png proteindisplay.png   pubmed.jpg   textpresso.jpg  

</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>

Notes

[back to top]


Fur and OxyR regulons. Regulated by MntR. NRAMP family.[4]



Gene

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css> <protect>

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

mntH

Mnemonic

Mn transport

Synonyms

ECK2387, b2392, JW2388, mntA, yfeP[1], yfeP

</protect>

Notes

Location(s) and DNA Sequence

[back to top]


<protect> See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

54.09 minutes, 54.09 minutes 

MG1655: 2510728..2509490
<gbrowseImage> name=NC_000913:2509490..2510728 source=MG1655 preset=GeneLocation </gbrowseImage>

REL606

NC_012967: 2446931..2445693
<gbrowseImage> name=NC_012967:2445693..2446931 source=REL606 preset=GeneLocation </gbrowseImage>

BW2952

NC_012759: 2395295..2396533
<gbrowseImage> name=NC_012759:2395295..2396533 source=BW2952 preset=GeneLocation </gbrowseImage>

W3110

 

W3110: 2518152..2516914
<gbrowseImage> name=NC_007779:2516914..2518152 source=W3110 preset=GeneLocation </gbrowseImage>

DH10B

DH10B: 2602493..2601255
<gbrowseImage> name=NC_010473:2601255..2602493 source=DH10B preset=GeneLocation </gbrowseImage>

</protect>

Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

<protect></protect>

Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

ΔmntH (Keio:JW2388)

deletion

deletion

PMID:16738554

Shigen
CGSC9908[5]

mntHN37D

N37D

Loss of function

seeded from UniProt:P0A769

mntHE102D,Q

E102D,Q

Loss of function

seeded from UniProt:P0A769

mntHG36P

G36P

Loss of function

seeded from UniProt:P0A769

mntHD109E,N

D109E,N

Transports manganese to a very low level

seeded from UniProt:P0A769

mntHE112D,Q

E112D,Q

Transports manganese to a very low level

seeded from UniProt:P0A769

mntHP35N,Q

P35N,Q

Loss of function

seeded from UniProt:P0A769

mntHD34E,N

D34E,N

Loss of function

seeded from UniProt:P0A769

mntHG115A,P

G115A,P

Loss of function

seeded from UniProt:P0A769

mntHE154Q

E154Q

Transports manganese to a level half of that of wild-type

seeded from UniProt:P0A769

mntHD238N

D238N

Transports manganese to a very low level

seeded from UniProt:P0A769

ΔmntH729::kan

PMID:16738554

CGSC:101894


<protect></protect>

Notes

Genetic Interactions

[back to top]


<protect>

Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

</protect>

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW2388

Plasmid clone

Shigen

PMID:16769691

Status:Clone OK

Primer 1:GCCACGAACTATCGCGTTGAGAG

Primer 2:CCtAATCCCAGCGCCGTCCCCAC

12H4

Kohara Phage

Genobase

PMID:3038334

4G10

Kohara Phage

Genobase

PMID:3038334

zfd-1::Tn10

Linked marker

CAG18467 = CGSC7408[5]

est. P1 cotransduction: 52% [6]
Synonyms:zfb-1::Tn10

nupC510::Tn10

Linked marker

CAG18468 = CGSC7410[5]

est. P1 cotransduction: 98% [6]

<protect></protect>

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:G7254

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG14157

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120003828

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:946899

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB3909

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0007889

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]



Product(s)

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name

MntH

Synonyms

manganese/divalent cation transporter[1], B2392[2][1], MntA[2][1], MntH[2][1], YfeP[2][1] , ECK2387, JW2388, mntA, yfeP, b2392

Product description

MntH manganese ion transporter[2][3]

Mn(2+) transporter, role in bacterial response to reactive oxygen species; also transports Fe(2+), Cd(2+) and other divalent metals[4]

EC number (for enzymes)


<protect></protect>

Notes

Function

[back to top]


<protect> Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier GO ID GO term name Reference Evidence Code with/from Aspect Notes Status

GO:0015292

uniporter activity

PMID:10712688

IMP: Inferred from Mutant Phenotype

F

complete

GO:0015684

ferrous iron transport

PMID:10712688

IMP: Inferred from Mutant Phenotype

P

preference for Mn(II)

complete

GO:0030001

metal ion transport

PMID:10712688

IMP: Inferred from Mutant Phenotype

P

Mn(II) and Fe (II)

complete

GO:0005215

transporter activity

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR001046

F

Seeded from EcoCyc (v14.0)

complete

GO:0005886

plasma membrane

GOA:hamap
GO_REF:0000020

IEA: Inferred from Electronic Annotation

HAMAP:MF_00221

C

Seeded from EcoCyc (v14.0)

complete

GO:0005886

plasma membrane

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0997

C

Seeded from EcoCyc (v14.0)

complete

GO:0005886

plasma membrane

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-1003

C

Seeded from EcoCyc (v14.0)

complete

GO:0006828

manganese ion transport

GOA:hamap
GO_REF:0000020

IEA: Inferred from Electronic Annotation

HAMAP:MF_00221

P

Seeded from EcoCyc (v14.0)

complete

GO:0015293

symporter activity

GOA:hamap
GO_REF:0000020

IEA: Inferred from Electronic Annotation

HAMAP:MF_00221

F

Seeded from EcoCyc (v14.0)

complete

GO:0015293

symporter activity

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0769

F

Seeded from EcoCyc (v14.0)

complete

GO:0005886

plasma membrane

PMID:14607838

IDA: Inferred from Direct Assay

C

complete

GO:0016021

integral to membrane

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0812

C

Seeded from EcoCyc (v14.0)

complete

GO:0016021

integral to membrane

PMID:14607838

IMP: Inferred from Mutant Phenotype

C

complete

GO:0016021

integral to membrane

GO_REF:0000023

IEA: Inferred from Electronic Annotation

SP_SL:SL-9909

C

Seeded from EcoCyc (v14.0)

complete

GO:0030001

metal ion transport

PMID:14607838

IMP: Inferred from Mutant Phenotype

P

Cd(II)

complete

GO:0030001

metal ion transport

PMID:10712688

IMP: Inferred from Mutant Phenotype

P

Seeded from EcoCyc (v14.0)

complete

GO:0030001

metal ion transport

PMID:14607838

IMP: Inferred from Mutant Phenotype

P

Seeded from EcoCyc (v14.0)

complete

GO:0015293

symporter activity

PMID:18227061

IDA: Inferred from Direct Assay

F

complete

GO:0030145

manganese ion binding

GOA:hamap
GO_REF:0000020

IEA: Inferred from Electronic Annotation

HAMAP:MF_00221

F

Seeded from EcoCyc (v14.0)

complete

GO:0006824

cobalt ion transport

PMID:15641799

IMP: Inferred from Mutant Phenotype

P

complete

GO:0030145

manganese ion binding

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0464

F

Seeded from EcoCyc (v14.0)

complete

GO:0015691

cadmium ion transport

PMID:18227061

IDA: Inferred from Direct Assay

P

complete

GO:0006826

iron ion transport

PMID:15641799

IMP: Inferred from Mutant Phenotype

P

complete

GO:0006828

manganese ion transport

PMID:15641799

IMP: Inferred from Mutant Phenotype

P

complete

GO:0015691

cadmium ion transport

PMID:15641799

IMP: Inferred from Mutant Phenotype

P

complete

GO:0015078

hydrogen ion transmembrane transporter activity

PMID:15641799

IMP: Inferred from Mutant Phenotype

F

complete

GO:0005384

manganese ion transmembrane transporter activity

PMID:15641799

IMP: Inferred from Mutant Phenotype

F

complete

GO:0015086

cadmium ion transmembrane transporter activity

PMID:15641799

IMP: Inferred from Mutant Phenotype

F

complete

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type Partner Notes References Evidence

</protect>

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment Description Evidence Reference/Source Notes

plasma membrane

C-terminus localized to the periplasm with 11 predicted transmembrane domains

Daley et al. (2005) [7]

plasma membrane

From EcoCyc[3]


<protect></protect>

Notes

Structure and Physical Properties

[back to top]


<protect> Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence

at EcoCyc

MTNYRVESSS GRAARKMRLA LMGPAFIAAI GYIDPGNFAT NIQAGASFGY QLLWVVVWAN
LMAMLIQILS AKLGIATGKN LAEQIRDHYP RPVVWFYWVQ AEIIAMATDL AEFIGAAIGF
KLILGVSLLQ GAVLTGIATF LILMLQRRGQ KPLEKVIGGL LLFVAAAYIV ELIFSQPNLA
QLGKGMVIPS LPTSEAVFLA AGVLGATIMP HVIYLHSSLT QHLHGGSRQQ RYSATKWDVA
IAMTIAGFVN LAMMATAAAA FHFSGHTGVA DLDEAYLTLQ PLLSHAAATV FGLSLVAAGL
SSTVVGTLAG QVVMQGFIRF HIPLWVRRTV TMLPSFIVIL MGLDPTRILV MSQVLLSFGI
ALALVPLLIF TSDSKLMGDL VNSKRVKQTG WVIVVLVVAL NIWLLVGTAL GL
Length

412

Mol. Wt

44.194 kDa

pI

10.2 (calculated)

Extinction coefficient

57,410 (calc based on 9 Y, 8 W, and 0 C residues)


Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type Residues Description Notes References

Domain

38..384

PF01566 Natural resistance-associated macrophage protein

PMID:19920124

<motif_map/>

tmhmm.php?gene=mntH&show=pic&.jpg
Click the image to view raw output from TMHMM.

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=mntH taxon=562,83333 </beststructure>

Models

View models at:

</protect>

Structure figures

<protect>

</protect>

Notes

Gene Product Resources

[back to top]


See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type Source Notes/Reference

<protect></protect>

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

NCBI (Protein) (EcoliWiki Page)

GI:16130324

Escherichia coli str. K-12 substr. MG1655

NCBI (Protein) (EcoliWiki Page)

GeneID:946899

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0007889

Escherichia coli str. K-12 substr. MG1655

UniProt (EcoliWiki Page)

UniProtKB/Swiss-Prot:P0A769

Escherichia coli str. K-12 substr. MG1655

EcoCyc

EcoCyc:G7254

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG14157

Escherichia coli str. K-12 substr. MG1655

NCBI (Gene) (EcoliWiki Page)

GeneID:946899

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120003828

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB3909

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]




Expression

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.


Cellular Levels

[back to top]


See Help:Cellular levels

Molecule Organism or Strain Value Units Experimental Conditions Assay used Notes Reference(s)

Protein

E. coli K-12 MG1655

136

molecules/cell/generation

  • Medium: MOPS Complete
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Protein

E. coli K-12 MG1655

58

molecules/cell/generation

  • Medium: MOPS Minimal
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Protein

E. coli K-12 MG1655

57

molecules/cell/generation

  • Medium: MOPS Complete without Methionine
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Notes

Transcription and Transcriptional Regulation

[back to top]


<protect>

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)

mntH

Figure courtesy of RegulonDB

</protect>

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]


<protect><gbrowseImage> name=NC_000913:2510708..2510748 source=MG1655 flip=1 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

</protect>

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]


<protect> Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name Mutation Phenotype Reference


Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type Reference Notes

microarray

GEO Profiles:b2392 (EcoliWiki Page)

NCBI GEO profiles for mntH

microarray

GenExpDB:b2392 (EcoliWiki Page)

Summary of data for mntH from multiple microarray studies


Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name Resource Type Description Source Notes

<protect></protect>

Notes

Accessions Related to mntH Expression

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:G7254

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB3909

Escherichia coli str. K-12 substr. MG1655

EcoliGenExpDB (EcoliWiki Page)

EcoliGenExpDB:b2392

EcoGene

EcoGene:EG14157

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120003828

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0007889

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]



Evolution

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]


See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism Homologs (Statistics) Comments

Anopheles gambiae

  • ENSANGP00000000870 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Apis mellifera

  • ENSAPMP00000028846 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Arabidopsis thaliana

  • AT1G80830 (score: 1.000; bootstrap: 99%)
  • AT1G15960 (score: 0.824)
  • AT5G67330 (score: 0.090)
  • AT2G23150 (score: 0.081)
  • AT1G47240 (score: 0.080)
  • AT4G18790 (score: 0.076)

From Inparanoid:20070104

Bos taurus

  • ENSBTAP00000020627 (score: 1.000; bootstrap: 100%)
  • ENSBTAP00000019132 (score: 0.522)
  • ENSBTAP00000003041 (score: 0.477)

From Inparanoid:20070104

Caenorhabditis briggsae

  • WBGene00032133 (score: 1.000; bootstrap: 100%)
  • WBGene00032134 (score: 0.558)
  • WBGene00034569 (score: 0.413)

From Inparanoid:20070104

Caenorhabditis elegans

  • WBGene00004876 (score: 1.000; bootstrap: 100%)
  • WBGene00004877 (score: 0.529)
  • WBGene00004878 (score: 0.428)

From Inparanoid:20070104

Canis familiaris

  • ENSCAFP00000021599 (score: 1.000; bootstrap: 100%)
  • ENSCAFP00000011707 (score: 0.514)

From Inparanoid:20070104

Ciona intestinalis

  • ENSCINP00000002584 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Danio rerio

  • ZDB-GENE-021115-1 (score: 1.000; bootstrap: 100%)
  • ZDB-EST-020816-48 (score: 0.310)

From Inparanoid:20070104

Dictyostelium discoideum

  • DDB0232114 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Drosophila melanogaster

  • FBgn0011672 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Drosophila pseudoobscura

  • GA17603-PA (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Gallus gallus

  • ENSGALP00000018625 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Homo sapiens

  • ENSP00000233202 (score: 1.000; bootstrap: 100%)
  • ENSP00000262051 (score: 0.548)

From Inparanoid:20070104

Macaca mulatta

  • ENSMMUP00000017559 (score: 1.000; bootstrap: 100%)
  • ENSMMUP00000030244 (score: 0.234)

From Inparanoid:20070104

Monodelphis domestica

  • ENSMODP00000019331 (score: 1.000; bootstrap: 100%)
  • ENSMODP00000006316 (score: 0.558)

From Inparanoid:20070104

Mus musculus

  • MGI:1345275 (score: 1.000; bootstrap: 100%)
  • MGI:1345279 (score: 0.546)

From Inparanoid:20070104

Oryza gramene

  • Q653V6 (score: 1.000; bootstrap: 99%)
  • P93428 (score: 0.441)
  • Q8H4H5 (score: 0.419)
  • Q41268 (score: 0.393)
  • Q8GTY9 (score: 0.387)
  • Q6ZG85 (score: 0.313)
  • Q5QN13 (score: 0.212)
  • O24209 (score: 0.071)

From Inparanoid:20070104

Pan troglodytes

  • ENSPTRP00000008445 (score: 1.000; bootstrap: 100%)
  • ENSPTRP00000022081 (score: 0.364)

From Inparanoid:20070104

Rattus norvegicus

  • ENSRNOP00000020491 (score: 1.000; bootstrap: 100%)
  • ENSRNOP00000026494 (score: 0.325)

From Inparanoid:20070104

Saccharomyces cerevisiae

  • YLR034C (score: 1.000; bootstrap: 100%)
  • YHR050W (score: 0.373)
  • YOL122C (score: 0.332)

From Inparanoid:20070104

Schizosaccharomyces pombe

  • SPAC27F18 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Takifugu rubripes

  • NEWSINFRUP00000144221 (score: 1.000; bootstrap: 100%)
  • NEWSINFRUP00000136565 (score: 0.581)

From Inparanoid:20070104

Tetraodon nigroviridis

  • GSTENP00013613001 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Xenopus tropicalis

  • ENSXETP00000032692 (score: 1.000; bootstrap: 100%)
  • ENSXETP00000021227 (score: 0.550)

From Inparanoid:20070104

Shigella flexneri

MNTH

From SHIGELLACYC

E. coli O157

Z3658

From ECOO157CYC


Do-It-Yourself Web Tools

<protect></protect>

Notes

Families

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

Pfam (EcoliWiki Page)

PF01566 Natural resistance-associated macrophage protein

Panther (EcoliWiki Page)

PTHR11706:SF22

EcoCyc

EcoCyc:G7254

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG14157

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120003828

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB3909

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0007889

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]



References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  3. 3.0 3.1 3.2 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  4. 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
  5. 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
  6. 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
  7. Daley, DO et al. (2005) Global topology analysis of the Escherichia coli inner membrane proteome. Science 308 1321-3 PubMed

Categories

[back to top]