mhpB:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
mhpB |
|---|---|
| Mnemonic |
m-Hydroxyphenylpropionic acid |
| Synonyms |
ECK0345, b0348, JW0339[1], JW0339 |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
7.96 minutes |
MG1655: 369501..370445 |
||
|
NC_012967: 342833..343777 |
||||
|
W3110 |
|
W3110: 369501..370445 |
||
|
DH10B: 1388944..1389888 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
369501 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
mhpB(del) (Keio:JW0339) |
deletion |
deletion |
|||||
|
mhpBD114N |
D114N |
Low level of catalytic activity, 600-fold lower than the wild-type enzyme. More than 8000-fold decrease in affinity |
seeded from UniProt:P0ABR9 | ||||
|
mhpBD114A |
D114A |
Complete loss of extradiol cleavage activity |
seeded from UniProt:P0ABR9 | ||||
|
mhpBP181H |
P181H |
More than 60-fold decrease in catalytic activity and affinity |
seeded from UniProt:P0ABR9 | ||||
|
mhpBH115A |
H115A |
Complete loss of extradiol cleavage activity |
seeded from UniProt:P0ABR9 | ||||
|
mhpBH115Q |
H115Q |
Complete loss of activity |
seeded from UniProt:P0ABR9 | ||||
|
mhpBH115Y |
H115Y |
Complete loss of activity |
seeded from UniProt:P0ABR9 | ||||
|
mhpBH179A |
H179A |
Complete loss of activity |
seeded from UniProt:P0ABR9 | ||||
|
mhpBH179Q |
H179Q |
Complete loss of activity |
seeded from UniProt:P0ABR9 | ||||
|
mhpBH179Y |
H179Y |
Complete loss of activity |
seeded from UniProt:P0ABR9 | ||||
|
mhpBP181A |
P181A |
More than 2-fold decrease in catalytic activity and 100-fold decrease in affinity |
seeded from UniProt:P0ABR9 | ||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0339 |
Plasmid clone |
Status:Clone OK Primer 1:GCCCACGCTTATCTTCACTGTCT Primer 2:CCGTTCTCTGTTCTGGCGCTTAA | |
|
Linked marker |
est. P1 cotransduction: 91% [6] | ||
|
Linked marker |
est. P1 cotransduction: 95% [6] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Bugg, TD (1993) Overproduction, purification and properties of 2,3-dihydroxyphenylpropionate 1,2-dioxygenase from Escherichia coli. Biochim. Biophys. Acta 1202 258-64 PubMed
- ↑ Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 5.0 5.1 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
