lpd:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
lpd |
|---|---|
| Mnemonic |
Lipoamide dehydrogenase |
| Synonyms |
ECK0115, b0116, JW0112, dhl, lpdA[1], lpdA |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
2.76 minutes |
MG1655: 127912..129336 |
||
|
NC_012759: 127911..129335 |
||||
|
W3110 |
|
W3110: 127912..129336 |
||
|
DH10B: 102016..103440 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
127915 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
lpd(del) (Keio:JW0112) |
deletion |
deletion |
|||||
|
lpdA(del)::kan |
deletion |
Biolog:respiration |
unable to respire Dextrin |
||||
|
lpdA(del)::kan |
deletion |
Biolog:respiration |
unable to respire D-Galactose |
||||
|
lpdA(del)::kan |
deletion |
Biolog:respiration |
unable to respire b-Methyl-D-glucoside |
||||
|
lpdA(del)::kan |
deletion |
Biolog:respiration |
unable to respire DL-a-Glycerol |
||||
|
lpdA(del)::kan |
deletion |
Biolog:respiration |
unable to respire D-Galactoniate |
||||
|
lpdA(del)::kan |
deletion |
Biolog:respiration |
unable to respire D-Galacturonate |
||||
|
lpdA(del)::kan |
deletion |
Biolog:respiration |
unable to respire D-Glucuronate |
||||
|
lpdA(del)::kan |
deletion |
Biolog:respiration |
unable to respire Acetate |
||||
|
lpdA(del)::kan |
deletion |
Biolog:respiration |
unable to respire a-Hydroxybutyrate |
||||
|
lpdA(del)::kan |
deletion |
Biolog:respiration |
unable to respire a-Ketobutyrate |
||||
|
lpdA(del)::kan |
deletion |
Biolog:respiration |
unable to respire a-Ketoglutarate |
||||
|
lpdA(del)::kan |
deletion |
Biolog:respiration |
unable to respire DL-Lactate |
||||
|
lpdA(del)::kan |
deletion |
Biolog:respiration |
unable to respire Succinate |
||||
|
lpdA(del)::kan |
deletion |
Biolog:respiration |
unable to respire Bromosuccinate |
||||
|
lpdA(del)::kan |
deletion |
Biolog:respiration |
unable to respire Glucuronamide |
||||
|
lpdA(del)::kan |
deletion |
Biolog:respiration |
unable to respire L-Alanine |
||||
|
lpdA(del)::kan |
deletion |
Biolog:respiration |
unable to respire L-Alanyl-glycine |
||||
|
lpdA(del)::kan |
deletion |
Biolog:respiration |
unable to respire L-Asparagine |
||||
|
lpdA(del)::kan |
deletion |
Biolog:respiration |
unable to respire L-Aspartate |
||||
|
lpdA(del)::kan |
deletion |
Biolog:respiration |
unable to respire Glycyl-L-aspartate |
||||
|
lpdA(del)::kan |
deletion |
Biolog:respiration |
unable to respire D-Serine |
||||
|
lpdA(del)::kan |
deletion |
Biolog:respiration |
unable to respire L-Serine |
||||
|
lpdA(del)::kan |
deletion |
Biolog:respiration |
unable to respire Uridine |
||||
|
Mutation in lpd allele of strain: SE2377, SE2383, SE2384. |
C->T at position 964 |
H322Y |
Growth Phenotype |
Reduces sensitivity of PDH to NADH inhibition during anaerobic growth, thereby allowing this enzyme to catalyze ethanol production by fermentation. |
|||
|
Mutation in lpd allele of strain: SE2378, SE2382, SE2385. |
G->A at position 1060 |
E354K |
Growth Phenotype |
Reduces sensitivity of PDH to NADH inhibition during anaerobic growth, thereby allowing this enzyme to catalyze ethanol production by fermentation. |
|||
|
lpd-1 |
|||||||
|
lpd-10 |
|||||||
|
lpd-734(del)::kan |
| ||||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0112 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAGTACTGAAATCAAAACTCA Primer 2:CCCTTCTTCTTCGCTTTCGGGTT | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
leuO3051::Tn10 |
Linked marker |
est. P1 cotransduction: 14% [10] | |
|
Linked marker |
est. P1 cotransduction: 47% [10] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Stephens, PE et al. (1983) Nucleotide sequence of the lipoamide dehydrogenase gene of Escherichia coli K12. Eur. J. Biochem. 135 519-27 PubMed
- ↑ Link, AJ et al. (1997) Comparing the predicted and observed properties of proteins encoded in the genome of Escherichia coli K-12. Electrophoresis 18 1259-313 PubMed
- ↑ 4.0 4.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
- ↑ 6.00 6.01 6.02 6.03 6.04 6.05 6.06 6.07 6.08 6.09 6.10 6.11 6.12 6.13 6.14 6.15 6.16 6.17 6.18 6.19 6.20 6.21 6.22 Ito, M et al. (2005) Functional analysis of 1440 Escherichia coli genes using the combination of knock-out library and phenotype microarrays. Metab. Eng. 7 318-27 PubMed
- ↑ 7.0 7.1 Kim, Y et al. (2008) Dihydrolipoamide dehydrogenase mutation alters the NADH sensitivity of pyruvate dehydrogenase complex of Escherichia coli K-12. J. Bacteriol. 190 3851-8 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 9.0 9.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 10.0 10.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
