ligA:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
ligA |
|---|---|
| Mnemonic |
Ligase |
| Synonyms |
ECK2406, b2411, JW2403, dnaL, lig, pdeC, lop[1], lop |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
54.45 minutes |
MG1655: 2528198..2526183 |
||
|
NC_012967: 2458902..2456887 |
||||
|
NC_012759: 2411988..2414003 |
||||
|
W3110 |
|
W3110: 2535622..2533607 |
||
|
DH10B: 2619963..2617948 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
2526183 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ligAVI383AA |
VI383AA |
Reduces nick joining activity by 95% |
seeded from UniProt:P15042 | ||||
|
ligARR446AA |
RR446AA |
Reduces nick joining activity by 95% |
seeded from UniProt:P15042 | ||||
|
ligAG455A |
G455A |
Reduces nick joining activity by 50% |
seeded from UniProt:P15042 | ||||
|
ligAG455D,V |
G455D,V |
Reduces nick joining activity by 95% |
seeded from UniProt:P15042 | ||||
|
ligAR487A |
R487A |
Reduces nick joining activity by over 90% |
seeded from UniProt:P15042 | ||||
|
ligAK314Q |
K314Q |
Reduces nick joining activity by 99% |
seeded from UniProt:P15042 | ||||
|
ligAK290A |
K290A |
Reduces nick joining activity by 87% |
seeded from UniProt:P15042 | ||||
|
ligAK314R |
K314R |
Reduces nick joining activity by 95% |
seeded from UniProt:P15042 | ||||
|
ligAR333A,Q |
R333A,Q |
Reduces nick joining activity by over 95%. Abolishes nick joining activity; when associated with A-334 |
seeded from UniProt:P15042 | ||||
|
ligAT334A |
T334A |
Abolishes nick joining activity; when associated with A-333 |
seeded from UniProt:P15042 | ||||
|
ligAD285N |
D285N |
Reduces nick joining activity by 99% |
seeded from UniProt:P15042 | ||||
|
ligAG286A |
G286A |
Reduces nick joining activity by 86% |
seeded from UniProt:P15042 | ||||
|
ligAV288A |
V288A |
Reduces nick joining activity by 25% |
seeded from UniProt:P15042 | ||||
|
ligAY35F |
Y35F |
Reduces nick joining activity by 77% |
seeded from UniProt:P15042 | ||||
|
ligAY35S |
Y35S |
Reduces nick joining activity by 99.9% |
seeded from UniProt:P15042 | ||||
|
ligAD36A |
D36A |
Reduces nick joining activity by 99.8% |
seeded from UniProt:P15042 | ||||
|
ligAD36E |
D36E |
Reduces nick joining activity by 96% |
seeded from UniProt:P15042 | ||||
|
ligAD36N |
D36N |
Reduces nick joining activity by 88% |
seeded from UniProt:P15042 | ||||
|
ligAK115Q,R |
K115Q,R |
Reduces nick joining activity by 99.9% |
seeded from UniProt:P15042 | ||||
|
ligAD117E |
D117E |
Reduces nick joining activity by 97% |
seeded from UniProt:P15042 | ||||
|
ligAD117N |
D117N |
Reduces nick joining activity by 99.9% |
seeded from UniProt:P15042 | ||||
|
ligAG118A |
G118A |
Reduces nick joining activity by 99.9% |
seeded from UniProt:P15042 | ||||
|
ligAD138A |
D138A |
Reduces nick joining activity by 63% |
seeded from UniProt:P15042 | ||||
|
ligAE143A |
E143A |
Reduces nick joining activity by 48% |
seeded from UniProt:P15042 | ||||
|
ligAD32N |
D32N |
Reduces nick joining activity by 91% |
seeded from UniProt:P15042 | ||||
|
ligAE173A,D,Q |
E173A,D,Q |
Reduces nick joining activity by 99.9% |
seeded from UniProt:P15042 | ||||
|
ligAN198A |
N198A |
Reduces nick joining activity by 74% |
seeded from UniProt:P15042 | ||||
|
ligAR342A |
R342A |
Reduces nick joining activity by 80% |
seeded from UniProt:P15042 | ||||
|
ligAR379A,Q |
R379A,Q |
Reduces nick joining activity by over 95% |
seeded from UniProt:P15042 | ||||
|
ligAG489D,V |
G489D,V |
Reduces nick joining activity by 95% |
seeded from UniProt:P15042 | ||||
|
ligAG521A |
G521A |
Reduces nick joining activity by 95% |
seeded from UniProt:P15042 | ||||
|
ligAY35A |
Y35A |
Reduces nick joining activity by 98% |
seeded from UniProt:P15042 | ||||
|
ligAG521D,V |
G521D,V |
Loss of nick joining activity |
seeded from UniProt:P15042 | ||||
|
ligAG553D,V |
G553D,V |
Reduces nick joining activity by 95% |
seeded from UniProt:P15042 | ||||
|
ligAR614A |
R614A |
Reduces nick joining activity by 85% |
seeded from UniProt:P15042 | ||||
|
ligAR200A,K,Q |
R200A,K,Q |
Reduces nick joining activity by 99.9% |
seeded from UniProt:P15042 | ||||
|
ligAR208A,K,Q |
R208A,K,Q |
Reduces nick joining activity by 99% |
seeded from UniProt:P15042 | ||||
|
ligAR277A |
R277A |
Reduces nick joining activity by 99% |
seeded from UniProt:P15042 | ||||
|
ligAD285E |
D285E |
Reduces nick joining activity by 96% |
seeded from UniProt:P15042 | ||||
|
ligAG172A |
G172A |
Reduces nick joining activity by 64% |
seeded from UniProt:P15042 | ||||
|
ligAE10A |
E10A |
No effect |
seeded from UniProt:P15042 | ||||
|
ligAY22A,S |
Y22A,S |
Reduces nick joining activity by 99.9% |
seeded from UniProt:P15042 | ||||
|
ligAY22F |
Y22F |
Reduces nick joining activity by 91% |
seeded from UniProt:P15042 | ||||
|
ligAH23A,Y |
H23A,Y |
Reduces nick joining activity by 90% |
seeded from UniProt:P15042 | ||||
|
ligAD32A,E |
D32A,E |
Reduces nick joining activity by 99% |
seeded from UniProt:P15042 | ||||
|
ligA251(ts) |
temperature sensitive |
||||||
|
ligA4 |
|||||||
|
ligA321 |
|||||||
|
'ligA(P)::Tn10dCam |
Mutagenesis rate |
Decreased stress-induced mutagenesis (SIM) phenotype. |
Parental Strain: SMR4562 Experimental Strain: SMR11973 |
Mutation was comparatively weak with decrease only happening to 33-67% of population. | |||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW2403 |
Plasmid clone |
Status:Clone OK Primer 1:GCCGAATCAATCGAACAACAACT Primer 2:CCGCTACCCAGCAAACGCAGCAT | |
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 56% [10] | ||
|
Linked marker |
est. P1 cotransduction: 2% [10] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Ishino, Y et al. (1986) Nucleotide sequence of the lig gene and primary structure of DNA ligase of Escherichia coli. Mol. Gen. Genet. 204 1-7 PubMed
- ↑ Dermody, JJ et al. (1979) Conditional-lethal deoxyribonucleic acid ligase mutant of Escherichia coli. J. Bacteriol. 139 701-4 PubMed
- ↑ Sevastopoulos, CG et al. (1977) Large-scale automated isolation of Escherichia coli mutants with thermosensitive DNA replication. Proc. Natl. Acad. Sci. U.S.A. 74 3485-9 PubMed
- ↑ Gottesman, MM et al. (1973) Genetics and function of DNA ligase in Escherichia coli. J. Mol. Biol. 77 531-47 PubMed
- ↑ Al Mamun, AA et al. (2012) Identity and function of a large gene network underlying mutagenic repair of DNA breaks. Science 338 1344-8 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 9.0 9.1 CGSC: The Coli Genetics Stock Center
- ↑ 10.0 10.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
