{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

On One Page

Quickview |

Gene |

Product(s) |

Expression|

Evolution |

References |

Quickview

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Standard Name	iscA
Gene Synonym(s)	ECK2525, b2528, JW2512, yfhF^[1], yfhF
Product Desc.	iron-sulfur cluster assembly protein^[2]^[3] Recruit and deliver Fe for Fe-S cluster assembly in IscU; possibly an alternative scaffold for Fe-S cluster assembly^[4]
Product Synonyms(s)	FeS cluster assembly protein^[1], B2528^[2]^[1], IscA^[2]^[1], YfhF^[2]^[1] , ECK2525, JW2512, yfhF, b2528
Function from GO	<GO_nr />
Knock-Out Phenotype
Regulation/Expression	transcription unit(s): iscRSUA^[2]
Regulation/Activity
Quick Links
edit table

</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>

Notes

[back to top]

iscA, sufA, erpA and nfuA are paralogs.^[4]

Gene

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css> <protect>

Nomenclature

[back to top]

See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name	iscA
Mnemonic	Iron-sulfur cluster
Synonyms	ECK2525, b2528, JW2512, yfhF^[1], yfhF
edit table

</protect>

Notes

Location(s) and DNA Sequence

[back to top]

<protect> See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain	Map location	Genome coordinates	Genome browsers	Sequence links
MG1655	57.28 minutes	MG1655: 2657908..2657585 <gbrowseImage> name=NC_000913:2657585..2657908 source=MG1655 preset=GeneLocation </gbrowseImage>	EcoCyc GBrowse(MG1655)	FASTA Dump EcoCyc Sequence Dump
REL606		NC_012967: 2580585..2580262 <gbrowseImage> name=NC_012967:2580262..2580585 source=REL606 preset=GeneLocation </gbrowseImage>	GBrowse (REL606)	FASTA Dump
BW2952		NC_012759: 2543390..2543713 <gbrowseImage> name=NC_012759:2543390..2543713 source=BW2952 preset=GeneLocation </gbrowseImage>	GBrowse (BW2952)	FASTA Dump
W3110		W3110: 2658542..2658219 <gbrowseImage> name=NC_007779:2658219..2658542 source=W3110 preset=GeneLocation </gbrowseImage>	GBrowse(W3110)	FASTA Dump
DH10B		DH10B: 2749673..2749350 <gbrowseImage> name=NC_010473:2749350..2749673 source=DH10B preset=GeneLocation </gbrowseImage>	GBrowse(DH10B)	FASTA Dump
edit table

</protect>

Notes

Sequence Features

[back to top]

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type	Strain	Genomic Location	Evidence	Reference	Notes
edit table

Notes

Alleles and Phenotypes

[back to top]

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele	Nt change(s)	AA change(s)	Phenotype: Type	Phenotype: Description	Reference	Availability	Comments
ΔiscA (Keio:JW2512)	deletion	deletion			PMID:16738554	Shigen CGSC10000^[5]
iscAC35S		C35S		Decrease of iron binding activity			seeded from UniProt:P0AAC8
iscAC99S		C99S		Loss of iron binding activity			seeded from UniProt:P0AAC8
iscAC101S		C101S		Loss of iron binding activity			seeded from UniProt:P0AAC8
ΔiscA774::kan					PMID:16738554	CGSC:101584
IscA(del)	deletion	deletion	Auxotrophies	Isc is an ATC protein (A-type carrier protein) involved in the maturation of the nitrate-indicuble, multisubunit anaerobix respiratory enzymes Formate dehydrogenase-N (Fdh-N) and nitrate reductase (Nar). Deletion of Isc strongly reduces expression of both Fdh-N and Nar enzymes. Cross-complementation experiments demonstrated that multicopy IscA could partially compensate for lack of ErpA with respect to Fdh-N activity but not Nar activity. These findings suggest that erpA and IscA have overlapping roles in assembly of these anaerobic respiratory enzymes but demonstrate that ErpA is essential for the production of active enzymes, table 2.	PMID:22081393	experimental strain: CP477
edit table

Notes

Genetic Interactions

[back to top]

Interactor	Interaction	Allele	Score(s)	Reference(s)	Accessions	Notes
edit table

</protect>

Notes

Genetic Resources

[back to top]

See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource	Resource Type	Source	Notes/Reference
JW2512	Plasmid clone	Shigen	PMID:16769691 Status:Clone OK Primer 1:GCCTCGATTACACTGAGCGACAG Primer 2:CCAACGTGGAAGCTTTCGCCGCA
5E10	Kohara Phage	Genobase	PMID:3038334
purC80::Tn10	Linked marker	CAG18470 = CGSC7413^[5]	est. P1 cotransduction: 3% ^[6]
zfh-208::Tn10	Linked marker	CAG18481 = CGSC7417^[5]	est. P1 cotransduction: 83% ^[6] Synonyms:zff-208::Tn10
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG12132	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG12132	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120002034	Escherichia coli str. K-12 substr. MG1655
NCBI (EcoliWiki Page)	GeneID:946999	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB2053	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0008319	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Product(s)

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name	IscA
Synonyms	FeS cluster assembly protein^[1], B2528^[2]^[1], IscA^[2]^[1], YfhF^[2]^[1] , ECK2525, JW2512, yfhF, b2528
Product description	iron-sulfur cluster assembly protein^[2]^[3] Recruit and deliver Fe for Fe-S cluster assembly in IscU; possibly an alternative scaffold for Fe-S cluster assembly^[4]
EC number (for enzymes)
edit table

Notes

Function

[back to top]

<protect> Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier	GO ID	GO term name	Reference	Evidence Code	with/from	Aspect	Notes	Status
	GO:0005198	structural molecule activity	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR016092	F	Seeded from EcoCyc (v14.0)	complete
	GO:0005506	iron ion binding	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_01429	F	Seeded from EcoCyc (v14.0)	complete
	GO:0005506	iron ion binding	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR011302	F	Seeded from EcoCyc (v14.0)	complete
	GO:0005506	iron ion binding	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0408	F	Seeded from EcoCyc (v14.0)	complete
	GO:0005515	protein binding	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR011302	F	Seeded from EcoCyc (v14.0)	complete
	GO:0016226	iron-sulfur cluster assembly	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR011302	P	Seeded from EcoCyc (v14.0)	complete
	GO:0016226	iron-sulfur cluster assembly	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR016092	P	Seeded from EcoCyc (v14.0)	complete
	GO:0046872	metal ion binding	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0479	F	Seeded from EcoCyc (v14.0)	complete
edit table

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type	Partner	References	Evidence
Protein	dps	PMID:16606699	Experiment(s):EBI-1143152
Protein	rplB	PMID:16606699	Experiment(s):EBI-1143152
Protein	msrA	PMID:16606699	Experiment(s):EBI-1143152
Protein	talA	PMID:19402753	MALDI(Z-score):38.145932
edit table

</protect>

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment	Description	Evidence	Reference/Source	Notes
edit table

Notes

Structure and Physical Properties

[back to top]

<protect> Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence	at EcoCyc MSITLSDSAA ARVNTFLANR GKGFGLRLGV RTSGCSGMAY VLEFVDEPTP EDIVFEDKGV KVVVDGKSLQ FLDGTQLDFV KEGLNEGFKF TNPNVKDECG CGESFHV
Length	107
Mol. Wt	11.555 kDa
pI	4.6 (calculated)
Extinction coefficient	1,490 - 1,865 (calc based on 1 Y, 0 W, and 3 C residues)
edit table

Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type	Residues	Description	Notes	References
Domain	3..93	PF01521 Iron-sulphur cluster biosynthesis		PMID:19920124
edit table

<motif_map/>

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=iscA taxon=562,83333 </beststructure>

Models

View models at:

edit table

</protect>

Structure figures

</protect>

Notes

Gene Product Resources

[back to top]

See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type	Source	Notes/Reference
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
NCBI (Protein) (EcoliWiki Page)	GI:16130453	Escherichia coli str. K-12 substr. MG1655
NCBI (Protein) (EcoliWiki Page)	GeneID:946999	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0008319	Escherichia coli str. K-12 substr. MG1655
UniProt (EcoliWiki Page)	UniProtKB/Swiss-Prot:P0AAC8	Escherichia coli str. K-12 substr. MG1655
EcoCyc	EcoCyc:EG12132	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG12132	Escherichia coli str. K-12 substr. MG1655
NCBI (Gene) (EcoliWiki Page)	GeneID:946999	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120002034	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB2053	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Expression

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Cellular Levels

[back to top]

See Help:Cellular levels

Molecule	Organism or Strain	Value	Units	Experimental Conditions	Assay used	Reference(s)
Protein	E. coli K-12 MG1655	5912	molecules/cell/generation	Medium: MOPS Complete Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	PMID: 24766808
Protein	E. coli K-12 MG1655	1974	molecules/cell/generation	Medium: MOPS Minimal Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	PMID: 24766808
Protein	E. coli K-12 MG1655	7674	molecules/cell/generation	Medium: MOPS Complete without Methionine Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	PMID: 24766808
edit table

Notes

Transcription and Transcriptional Regulation

[back to top]

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)
iscRSUA
edit table

Figure courtesy of RegulonDB

</protect>

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]

<protect><gbrowseImage> name=NC_000913:2657888..2657928 source=MG1655 flip=1 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

</protect>

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]

<protect> Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name	Mutation	Phenotype	Reference
edit table

Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type	Reference	Notes
microarray	GEO Profiles:b2528 (EcoliWiki Page)	NCBI GEO profiles for iscA
microarray	GenExpDB:b2528 (EcoliWiki Page)	Summary of data for iscA from multiple microarray studies
edit table

Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name	Resource Type	Description	Source	Notes
edit table

Notes

Accessions Related to iscA Expression

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG12132	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB2053	Escherichia coli str. K-12 substr. MG1655
EcoliGenExpDB (EcoliWiki Page)	EcoliGenExpDB:b2528
EcoGene	EcoGene:EG12132	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120002034	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0008319	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Evolution

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]

See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism	Homologs (Statistics)	Comments
Anopheles gambiae	ENSANGP00000002682 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Arabidopsis thaliana	AT2G16710 (score: 1.000; bootstrap: 71%) AT2G36260 (score: 0.444)	From Inparanoid:20070104
Bos taurus	ENSBTAP00000002267 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Caenorhabditis briggsae	WBGene00042927 (score: 1.000; bootstrap: 100%) WBGene00039495 (score: 0.952)	From Inparanoid:20070104
Caenorhabditis elegans	WBGene00012666 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Canis familiaris	ENSCAFP00000001921 (score: 1.000; bootstrap: 95%) ENSCAFP00000008997 (score: 0.909)	From Inparanoid:20070104
Ciona intestinalis	ENSCINP00000002940 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Danio rerio	ZDB-GENE-050626-94 (score: 1.000; bootstrap: 100%) ZDB-CDNA-050626-39 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Dictyostelium discoideum	DDB0206420 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Drosophila melanogaster	FBgn0026666 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Drosophila pseudoobscura	GA20890-PA (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Gallus gallus	ENSGALP00000020553 (score: 1.000; bootstrap: 98%)	From Inparanoid:20070104
Homo sapiens	ENSP00000257522 (score: 1.000; bootstrap: 100%) ENSP00000346040 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Macaca mulatta	ENSMMUP00000004535 (score: 1.000; bootstrap: 100%) ENSMMUP00000006684 (score: 0.371) ENSMMUP00000011413 (score: 0.276)	From Inparanoid:20070104
Monodelphis domestica	ENSMODP00000004347 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Mus musculus	MGI:1916296 (score: 1.000; bootstrap: 100%) MGI:3574096 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Oryza gramene	Q657Z2 (score: 1.000; bootstrap: 74%)	From Inparanoid:20070104
Pan troglodytes	ENSPTRP00000028963 (score: 1.000; bootstrap: 100%) ENSPTRP00000036025 (score: 0.880)	From Inparanoid:20070104
Rattus norvegicus	ENSRNOP00000024781 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Saccharomyces cerevisiae	YLL027W (score: 1.000; bootstrap: 80%)	From Inparanoid:20070104
Schizosaccharomyces pombe	SPCC6453c (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Takifugu rubripes	NEWSINFRUP00000136188 (score: 1.000; bootstrap: 100%) NEWSINFRUP00000142377 (score: 0.335)	From Inparanoid:20070104
Tetraodon nigroviridis	GSTENP00029628001 (score: 1.000; bootstrap: 100%) GSTENP00029627001 (score: 0.735)	From Inparanoid:20070104
Shigella flexneri	YFHF	From SHIGELLACYC
E. coli O157	YFHF	From ECOO157CYC
edit table

Do-It-Yourself Web Tools

Notes

Families

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
Pfam (EcoliWiki Page)	PF01521 Iron-sulphur cluster biosynthesis
Panther (EcoliWiki Page)	PTHR10072:SF27
Superfamily (EcoliWiki Page)	SUPERFAMILY:89360
EcoCyc	EcoCyc:EG12132	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG12132	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120002034	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB2053	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0008319	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

References

[back to top]

See Help:References for how to manage references in EcoliWiki.

↑ ^1.0 ^1.1 ^1.2 ^1.3 ^1.4 ^1.5 ^1.6 ^1.7 ^1.8 ^1.9 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
↑ ^2.0 ^2.1 ^2.2 ^2.3 ^2.4 ^2.5 ^2.6 ^2.7 ^2.8 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^3.0 ^3.1 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^4.0 ^4.1 ^4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
↑ ^5.0 ^5.1 ^5.2 CGSC: The Coli Genetics Stock Center
↑ ^6.0 ^6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

iscA:On One Page

Quickview

Notes

Gene

Nomenclature

Notes

Location(s) and DNA Sequence

Notes

Sequence Features

Notes

Alleles and Phenotypes

Notes

Genetic Interactions

Notes

Genetic Resources

Notes

Accessions in Other Databases

Notes

Links

Product(s)

Nomenclature

Notes

Function

Notes

Localization

Notes

Structure and Physical Properties

Structure figures

Notes

Gene Product Resources

Notes

Accessions in Other Databases

Notes

Links

Expression

Overview

Cellular Levels

Notes

Transcription and Transcriptional Regulation

Notes

Translation and Regulation of Translation

Notes

Turnover and Regulation of Turnover

Notes

Experimental

Notes

Accessions Related to iscA Expression

Notes

Links

Evolution

Homologs in Other Organisms

Do-It-Yourself Web Tools

Notes

Families

Notes

Links

References

Categories

Navigation menu

Search