iscA:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
iscA |
|---|---|
| Mnemonic |
Iron-sulfur cluster |
| Synonyms |
ECK2525, b2528, JW2512, yfhF[1], yfhF |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
57.28 minutes |
MG1655: 2657908..2657585 |
||
|
NC_012967: 2580585..2580262 |
||||
|
NC_012759: 2543390..2543713 |
||||
|
W3110 |
|
W3110: 2658542..2658219 |
||
|
DH10B: 2749673..2749350 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔiscA (Keio:JW2512) |
deletion |
deletion |
|||||
|
iscAC35S |
C35S |
Decrease of iron binding activity |
seeded from UniProt:P0AAC8 | ||||
|
iscAC99S |
C99S |
Loss of iron binding activity |
seeded from UniProt:P0AAC8 | ||||
|
iscAC101S |
C101S |
Loss of iron binding activity |
seeded from UniProt:P0AAC8 | ||||
|
ΔiscA774::kan |
|||||||
|
IscA(del) |
deletion |
deletion |
Auxotrophies |
Isc is an ATC protein (A-type carrier protein) involved in the maturation of the nitrate-indicuble, multisubunit anaerobix respiratory enzymes Formate dehydrogenase-N (Fdh-N) and nitrate reductase (Nar). Deletion of Isc strongly reduces expression of both Fdh-N and Nar enzymes. Cross-complementation experiments demonstrated that multicopy IscA could partially compensate for lack of ErpA with respect to Fdh-N activity but not Nar activity. These findings suggest that erpA and IscA have overlapping roles in assembly of these anaerobic respiratory enzymes but demonstrate that ErpA is essential for the production of active enzymes, table 2. |
experimental strain: CP477 |
| |
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW2512 |
Plasmid clone |
Status:Clone OK Primer 1:GCCTCGATTACACTGAGCGACAG Primer 2:CCAACGTGGAAGCTTTCGCCGCA | |
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 3% [7] | ||
|
Linked marker |
est. P1 cotransduction: 83% [7] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 3.0 3.1 3.2 CGSC: The Coli Genetics Stock Center
- ↑ Pinske, C & Sawers, RG (2012) A-type carrier protein ErpA is essential for formation of an active formate-nitrate respiratory pathway in Escherichia coli K-12. J. Bacteriol. 194 346-53 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 7.0 7.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
