infC:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
| Standard Name |
infC |
|---|---|
| Gene Synonym(s) |
ECK1716, b1718, JW5829, fit, srjA[1], srjA |
| Product Desc. |
protein chain initiation factor IF-3[2][3] Protein chain initiation factor IF3; unusual AUU start codon[4] |
| Product Synonyms(s) |
protein chain initiation factor IF-3[1], B1718[2][1], Fit[2][1], SrjA[2][1], InfC[2][1], IF3[2][1] , ECK1716, fit, JW5829, srjA, b1718 |
| Function from GO |
<GO_nr /> |
| Knock-Out Phenotype | |
| Regulation/Expression |
transcription unit(s): infC[2], thrS-infC-rpmI-rplT[2][3] |
| Regulation/Activity | |
| Quick Links | |
| edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
HT_Cmplx17_Mem: InfC+RpsG.[4]
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
infC |
|---|---|
| Mnemonic |
Initiation factor |
| Synonyms |
ECK1716, b1718, JW5829, fit, srjA[1], srjA |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
38.76 minutes |
MG1655: 1798662..1798120 |
||
|
NC_012967: 1777797..1777363 |
||||
|
NC_012759: 1690179..1690721 |
||||
|
W3110 |
|
W3110: 1802352..1801810 |
||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
1798120 |
Edman degradation |
PMID:330233 |
| |
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
infCY107F,L |
Y107F,L |
Reduced ribosome binding |
seeded from UniProt:P0A707 | ||||
|
infCK110R,L |
K110R,L |
Reduced ribosome binding |
seeded from UniProt:P0A707 | ||||
|
infC362 |
PMID:8858589 |
||||||
|
infC561 |
PMID:8858589 |
| |||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW5829 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCAAAGGCGGAAAACGAGTTCA Primer 2:CCtTGTTTCTTCTTAGGAGCGAG | |
|
Kohara Phage |
PMID:3038334 | ||
|
Kohara Phage |
PMID:3038334 | ||
|
Kohara Phage |
PMID:3038334 | ||
|
zdi-925::Tn10 |
Linked marker |
est. P1 cotransduction: 46% [6] | |
|
Linked marker |
est. P1 cotransduction: 25% [6] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG10506 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10506 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120000499 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EchoBASE:EB0501 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0005734 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
| Standard name |
InfC |
|---|---|
| Synonyms |
protein chain initiation factor IF-3[1], B1718[2][1], Fit[2][1], SrjA[2][1], InfC[2][1], IF3[2][1] , ECK1716, fit, JW5829, srjA, b1718 |
| Product description |
protein chain initiation factor IF-3[2][3] Protein chain initiation factor IF3; unusual AUU start codon[4] |
| EC number (for enzymes) |
|
| edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
| Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
|---|---|---|---|---|---|---|---|---|
|
GO:0003723 |
RNA binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0694 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0003743 |
translation initiation factor activity |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_00080 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0003743 |
translation initiation factor activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR001288 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0003743 |
translation initiation factor activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR019813 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0003743 |
translation initiation factor activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR019814 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0003743 |
translation initiation factor activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR019815 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0003743 |
translation initiation factor activity |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0396 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0005737 |
cytoplasm |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0963 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0005737 |
cytoplasm |
GO_REF:0000023 |
IEA: Inferred from Electronic Annotation |
SP_SL:SL-0086 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006412 |
translation |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0648 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006413 |
translational initiation |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_00080 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006413 |
translational initiation |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR001288 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006413 |
translational initiation |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR019813 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006413 |
translational initiation |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR019814 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006413 |
translational initiation |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR019815 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0016020 |
membrane |
PMID:16858726 |
IDA: Inferred from Direct Assay |
C |
Seeded from EcoCyc (v14.0) |
complete | ||
| edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
| Partner Type | Partner | Notes | References | Evidence |
|---|---|---|---|---|
|
Protein |
ynbC |
PMID:15690043 |
Experiment(s):EBI-889800 | |
|
Protein |
rng |
PMID:15690043 |
Experiment(s):EBI-889800 | |
|
Protein |
rplB |
PMID:15690043 |
Experiment(s):EBI-889800, EBI-894739 | |
|
Protein |
rplC |
PMID:15690043 |
Experiment(s):EBI-889800, EBI-894739 | |
|
Protein |
rplD |
PMID:15690043 |
Experiment(s):EBI-889800, EBI-894739 | |
|
Protein |
rplE |
PMID:15690043 |
Experiment(s):EBI-889800 | |
|
Protein |
rplJ |
PMID:15690043 |
Experiment(s):EBI-889800 | |
|
Protein |
rplK |
PMID:15690043 |
Experiment(s):EBI-889800 | |
|
Protein |
rpsA |
PMID:15690043 |
Experiment(s):EBI-889800, EBI-894739 | |
|
Protein |
rpsB |
PMID:15690043 |
Experiment(s):EBI-889800, EBI-894739 | |
|
Protein |
rpsC |
PMID:15690043 |
Experiment(s):EBI-889800, EBI-894739 | |
|
Protein |
rpsD |
PMID:15690043 |
Experiment(s):EBI-889800, EBI-894739 | |
|
Protein |
rpsE |
PMID:15690043 |
Experiment(s):EBI-889800, EBI-894739, EBI-884272 | |
|
Protein |
rpsF |
PMID:15690043 |
Experiment(s):EBI-889800, EBI-894739 | |
|
Protein |
rpsG |
PMID:15690043 |
Experiment(s):EBI-889800, EBI-894739 | |
|
Protein |
rpsJ |
PMID:15690043 |
Experiment(s):EBI-889800, EBI-894739 | |
|
Protein |
rpsK |
PMID:15690043 |
Experiment(s):EBI-889800 | |
|
Protein |
rpsM |
PMID:15690043 |
Experiment(s):EBI-889800, EBI-894739 | |
|
Protein |
ccmB |
PMID:15690043 |
Experiment(s):EBI-894739 | |
|
Protein |
dacA |
PMID:15690043 |
Experiment(s):EBI-894739 | |
|
Protein |
hupB |
PMID:15690043 |
Experiment(s):EBI-894739 | |
|
Protein |
rplI |
PMID:15690043 |
Experiment(s):EBI-894739 | |
|
Protein |
rplL |
PMID:15690043 |
Experiment(s):EBI-894739 | |
|
Protein |
rplM |
PMID:15690043 |
Experiment(s):EBI-894739 | |
|
Protein |
rplO |
PMID:15690043 |
Experiment(s):EBI-894739 | |
|
Protein |
rplP |
PMID:15690043 |
Experiment(s):EBI-894739 | |
|
Protein |
rplS |
PMID:15690043 |
Experiment(s):EBI-894739 | |
|
Protein |
rplT |
PMID:15690043 |
Experiment(s):EBI-894739 | |
|
Protein |
rplU |
PMID:15690043 |
Experiment(s):EBI-894739 | |
|
Protein |
rplV |
PMID:15690043 |
Experiment(s):EBI-894739 | |
|
Protein |
rplX |
PMID:15690043 |
Experiment(s):EBI-894739 | |
|
Protein |
rpmG |
PMID:15690043 |
Experiment(s):EBI-894739 | |
|
Protein |
rpsH |
PMID:15690043 |
Experiment(s):EBI-894739 | |
|
Protein |
rpsI |
PMID:15690043 |
Experiment(s):EBI-894739 | |
|
Protein |
rpsN |
PMID:15690043 |
Experiment(s):EBI-894739 | |
|
Protein |
rpsO |
PMID:15690043 |
Experiment(s):EBI-894739 | |
|
Protein |
rpsP |
PMID:15690043 |
Experiment(s):EBI-894739 | |
|
Protein |
rpsR |
PMID:15690043 |
Experiment(s):EBI-894739 | |
|
Protein |
rpsS |
PMID:15690043 |
Experiment(s):EBI-894739 | |
|
Protein |
rpsT |
PMID:15690043 |
Experiment(s):EBI-894739 | |
|
Protein |
rpsU |
PMID:15690043 |
Experiment(s):EBI-894739 | |
|
Protein |
yfiF |
PMID:15690043 |
Experiment(s):EBI-894739 | |
|
Protein |
yhbY |
PMID:15690043 |
Experiment(s):EBI-894739 | |
|
Protein |
sufC |
PMID:15690043 |
Experiment(s):EBI-894739 | |
|
Protein |
hupB |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
|
Protein |
rplK |
PMID:19402753 |
LCMS(ID Probability):90.0 MALDI(Z-score):17.053160 | |
|
Protein |
gyrA |
PMID:19402753 |
MALDI(Z-score):27.834783 | |
|
Protein |
rplS |
PMID:19402753 |
LCMS(ID Probability):99.0 MALDI(Z-score):4.182490 | |
|
Protein |
rpsT |
PMID:19402753 |
LCMS(ID Probability):99.4 | |
|
Protein |
rpsF |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):25.158298 | |
|
Protein |
rplO |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
|
Protein |
rplU |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
|
Protein |
rpsJ |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):13.119568 | |
|
Protein |
rpsP |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):2.271909 | |
|
Protein |
rpsN |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):6.774524 | |
|
Protein |
rplT |
PMID:19402753 |
LCMS(ID Probability):99.0 | |
|
Protein |
rpsS |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
|
Protein |
rpsA |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):27.307921 | |
|
Protein |
rpsM |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):31.815457 | |
|
Protein |
rpsH |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):2.028396 | |
|
Protein |
rpsR |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
|
Protein |
rpsC |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):36.139927 | |
|
Protein |
srmB |
PMID:19402753 |
MALDI(Z-score):27.406480 | |
|
Protein |
sufC |
PMID:19402753 |
LCMS(ID Probability):99.2 | |
|
Protein |
rpsD |
PMID:19402753 |
LCMS(ID Probability):99.6 MALDI(Z-score):37.639394 | |
|
Protein |
rpsI |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
|
Protein |
rplB |
PMID:19402753 |
LCMS(ID Probability):99.0 MALDI(Z-score):20.822580 | |
|
Protein |
rpsU |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
|
Protein |
clpA |
PMID:19402753 |
MALDI(Z-score):22.184306 | |
|
Protein |
dacA |
PMID:19402753 |
LCMS(ID Probability):99.2 | |
|
Protein |
rpsO |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
|
Protein |
parC |
PMID:19402753 |
MALDI(Z-score):28.844089 | |
|
Protein |
rplD |
PMID:19402753 |
LCMS(ID Probability):99.0 MALDI(Z-score):3.745052 | |
|
Protein |
yhbY |
PMID:19402753 |
LCMS(ID Probability):99.0 | |
|
Protein |
nadE |
PMID:19402753 |
MALDI(Z-score):39.214842 | |
|
Protein |
yfiF |
PMID:19402753 |
LCMS(ID Probability):99.0 | |
|
Protein |
rng |
PMID:19402753 |
MALDI(Z-score):18.226567 | |
|
Protein |
plsB |
PMID:19402753 |
MALDI(Z-score):25.207725 | |
| edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
| Compartment | Description | Evidence | Reference/Source | Notes |
|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
| Name | |
|---|---|
| Sequence |
MKGGKRVQTA RPNRINGEIR AQEVRLTGLE GEQLGIVSLR EALEKAEEAG VDLVEISPNA EPPVCRIMDY GKFLYEKSKS SKEQKKKQKV IQVKEIKFRP GTDEGDYQVK LRSLIRFLEE GDKAKITLRF RGREMAHQQI GMEVLNRVKD DLQELAVVES FPTKIEGRQM IMVLAPKKKQ |
| Length |
180 |
| Mol. Wt |
20.563 kDa |
| pI |
9.9 (calculated) |
| Extinction coefficient |
4,470 - 4,595 (calc based on 3 Y, 0 W, and 1 C residues) |
| edit table |
Domains/Motifs/Modification Sites
|
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
|
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
| Resource type | Source | Notes/Reference |
|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
ASAP:ABE-0005734 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EcoCyc:EG10506 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10506 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
RegulonDB:ECK120000499 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB0501 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
| Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
|---|---|---|---|---|---|---|---|
|
Protein |
E. coli K-12 MC4100 |
2.64E+04 |
molecules/cell |
|
emPAI |
PMID:18304323 | |
|
Protein |
E. coli K-12 MG1655 |
22624 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
5470 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
10419 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
| edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
|
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
Figure courtesy of RegulonDB |
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:1798642..1798682
source=MG1655
flip=1
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
| Allele Name | Mutation | Phenotype | Reference |
|---|---|---|---|
| edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
| Type | Reference | Notes |
|---|---|---|
|
microarray |
NCBI GEO profiles for infC | |
|
microarray |
Summary of data for infC from multiple microarray studies | |
| edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
| Resource Name | Resource Type | Description | Source | Notes |
|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions Related to infC Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG10506 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB0501 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10506 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120000499 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0005734 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
| Organism | Homologs (Statistics) | Comments |
|---|---|---|
|
Apis mellifera |
|
From Inparanoid:20070104 |
|
Arabidopsis thaliana |
|
From Inparanoid:20070104 |
|
Gallus gallus |
|
From Inparanoid:20070104 |
|
Monodelphis domestica |
|
From Inparanoid:20070104 |
|
Mus musculus |
|
From Inparanoid:20070104 |
|
Oryza gramene |
|
From Inparanoid:20070104 |
|
Takifugu rubripes |
|
From Inparanoid:20070104 |
|
Xenopus tropicalis |
|
From Inparanoid:20070104 |
|
Shigella flexneri |
INFC |
From SHIGELLACYC |
|
E. coli O157 |
INFC |
From ECOO157CYC |
| edit table |
Do-It-Yourself Web Tools
<protect></protect>
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
PF00707 Translation initiation factor IF-3, C-terminal domain |
||
|
PF05198 Translation initiation factor IF-3, N-terminal domain |
||
|
EcoCyc:EG10506 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10506 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120000499 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB0501 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0005734 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 2.11 2.12 2.13 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 3.2 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 5.0 5.1 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
Categories
- Genes with homologs in Apis mellifera
- Genes with homologs in Arabidopsis thaliana
- Genes with homologs in Gallus gallus
- Genes with homologs in Monodelphis domestica
- Genes with homologs in Mus musculus
- Genes with homologs in Oryza gramene
- Genes with homologs in Takifugu rubripes
- Genes with homologs in Xenopus tropicalis
- Genes with homologs in Shigella flexneri
- Genes with homologs in E. coli O157


