ihfB:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
| Standard Name |
ihfB |
|---|---|
| Gene Synonym(s) | |
| Product Desc. |
Component of IHF transcriptional dual regulator[2][3] Integration Host Factor (IHF), beta subunit; host infection, mutant phage lambda; site-specific recombination; sequence-specific DNA-binding transcriptional activator[4] |
| Product Synonyms(s) |
Integration host factor (IHF) beta subunit[5], B0912[2][5], IhfB[2][5], HimD[5], Hip[5], ECK0903, himD, hip, JW0895, b0912 |
| Function from GO |
<GO_nr /> |
| Knock-Out Phenotype | |
| Regulation/Expression |
transcription unit(s): rpsA-ihfB[2], rpsA-himD, ihfB[2], OP00241, himD |
| Regulation/Activity | |
| Quick Links | |
| edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
ihfB |
|---|---|
| Mnemonic |
Integration, host factor |
| Synonyms | |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
20.76 minutes |
MG1655: 963051..963335 |
||
|
NC_012759: 866019..866303 |
||||
|
W3110 |
|
W3110: 964250..964534 |
||
|
DH10B: 1016979..1017263 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
963051 |
Edman degradation |
PMID:9868784 |
| |
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔihfB (Keio:JW0895) |
deletion |
deletion |
PMID:16738554 |
||||
|
ihfBE44G,K,V |
E44G,K,V |
Altered DNA-binding specificity |
seeded from UniProt:P0A6Y1 | ||||
|
Δhip-1::cat |
PMID:3159903 |
||||||
|
ΔihfB735::kan |
PMID:16738554 |
| |||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0895 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCACCAAGTCAGAATTGATAGA Primer 2:CCACCGTAAATATTGGCGCGATC | |
|
Kohara Phage |
PMID:3038334 | ||
|
zca-1230::Tn10 |
Linked marker |
est. P1 cotransduction: 55% [7] | |
|
Linked marker |
est. P1 cotransduction: 19% [7] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG10441 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10441 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120000434 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EchoBASE:EB0436 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0003107 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
| Standard name |
IhfB |
|---|---|
| Synonyms |
Integration host factor (IHF) beta subunit[5], B0912[2][5], IhfB[2][5], HimD[5], Hip[5], ECK0903, himD, hip, JW0895, b0912 |
| Product description |
Component of IHF transcriptional dual regulator[2][3] Integration Host Factor (IHF), beta subunit; host infection, mutant phage lambda; site-specific recombination; sequence-specific DNA-binding transcriptional activator[4] |
| EC number (for enzymes) |
|
| edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
| Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
|---|---|---|---|---|---|---|---|---|
|
GO:0003677 |
DNA binding |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_00381 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0003677 |
DNA binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000119 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0003677 |
DNA binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR005685 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0003677 |
DNA binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR010992 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0003677 |
DNA binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR020816 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0003677 |
DNA binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0238 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0005694 |
chromosome |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR005685 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006310 |
DNA recombination |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_00381 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006310 |
DNA recombination |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR005685 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006310 |
DNA recombination |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0233 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006350 |
transcription |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0804 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006355 |
regulation of transcription, DNA-dependent |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_00381 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006355 |
regulation of transcription, DNA-dependent |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR005685 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006417 |
regulation of translation |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_00381 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006417 |
regulation of translation |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0810 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
Contributes to |
GO:0043565 |
sequence-specific DNA binding |
PMID:10551881 |
IDA: Inferred from Direct Assay |
F |
with IhfA |
complete | |
| edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
| Partner Type | Partner | Notes | References | Evidence |
|---|---|---|---|---|
|
Protein |
Subunits of IHF transcriptional dual regulator |
could be indirect |
||
|
Protein |
rplW |
PMID:15690043 |
Experiment(s):EBI-883484 | |
|
Protein |
rpmC |
PMID:15690043 |
Experiment(s):EBI-883484 | |
|
Protein |
rpmG |
PMID:15690043 |
Experiment(s):EBI-883484 | |
|
Protein |
rpoC |
PMID:15690043 |
Experiment(s):EBI-883484 | |
|
Protein |
rpsC |
PMID:15690043 |
Experiment(s):EBI-883484 | |
|
Protein |
rpsD |
PMID:15690043 |
Experiment(s):EBI-883484 | |
|
Protein |
rpsE |
PMID:15690043 |
Experiment(s):EBI-883484 | |
|
Protein |
rpsF |
PMID:15690043 |
Experiment(s):EBI-883484 | |
|
Protein |
rpsG |
PMID:15690043 |
Experiment(s):EBI-883484 | |
|
Protein |
rpsH |
PMID:15690043 |
Experiment(s):EBI-883484 | |
|
Protein |
rpsM |
PMID:15690043 |
Experiment(s):EBI-883484 | |
|
Protein |
rpsS |
PMID:15690043 |
Experiment(s):EBI-883484 | |
|
Protein |
uxuB |
PMID:15690043 |
Experiment(s):EBI-883484 | |
|
Protein |
yhbY |
PMID:15690043 |
Experiment(s):EBI-883484 | |
|
Protein |
yjgD |
PMID:15690043 |
Experiment(s):EBI-883484 | |
|
Protein |
rplM |
PMID:15690043 |
Experiment(s):EBI-883484 | |
|
Protein |
rplO |
PMID:15690043 |
Experiment(s):EBI-883484 | |
|
Protein |
rplP |
PMID:15690043 |
Experiment(s):EBI-883484 | |
|
Protein |
rplS |
PMID:15690043 |
Experiment(s):EBI-883484 | |
|
Protein |
rplU |
PMID:15690043 |
Experiment(s):EBI-883484 | |
|
Protein |
rplV |
PMID:15690043 |
Experiment(s):EBI-883484 | |
|
Protein |
aroB |
PMID:15690043 |
Experiment(s):EBI-883484 | |
|
Protein |
gltS |
PMID:15690043 |
Experiment(s):EBI-883484 | |
|
Protein |
hupA |
PMID:15690043 |
Experiment(s):EBI-883484 | |
|
Protein |
hupB |
PMID:15690043 |
Experiment(s):EBI-883484, EBI-884415 | |
|
Protein |
nusA |
PMID:15690043 |
Experiment(s):EBI-883484 | |
|
Protein |
rplA |
PMID:15690043 |
Experiment(s):EBI-883484 | |
|
Protein |
rplB |
PMID:15690043 |
Experiment(s):EBI-883484 | |
|
Protein |
rplC |
PMID:15690043 |
Experiment(s):EBI-883484 | |
|
Protein |
rplD |
PMID:15690043 |
Experiment(s):EBI-883484 | |
|
Protein |
rplE |
PMID:15690043 |
Experiment(s):EBI-883484 | |
|
Protein |
ihfA |
PMID:19402753 |
LCMS(ID Probability):99.0 MALDI(Z-score):17.053160 | |
|
Protein |
rpoC |
PMID:19402753 |
LCMS(ID Probability):99.0 | |
|
Protein |
aroB |
PMID:19402753 |
LCMS(ID Probability):99.0 | |
|
Protein |
uxuB |
PMID:19402753 |
LCMS(ID Probability):99.0 | |
|
Protein |
gltS |
PMID:19402753 |
LCMS(ID Probability):99.0 | |
| edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
| Compartment | Description | Evidence | Reference/Source | Notes |
|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
| Name | |
|---|---|
| Sequence |
MTKSELIERL ATQQSHIPAK TVEDAVKEML EHMASTLAQG ERIEIRGFGS FSLHYRAPRT GRNPKTGDKV ELEGKYVPHF KPGKELRDRA NIYG |
| Length |
94 |
| Mol. Wt |
10.65 kDa |
| pI |
9.8 (calculated) |
| Extinction coefficient |
4,470 (calc based on 3 Y, 0 W, and 0 C residues) |
| edit table |
Domains/Motifs/Modification Sites
|
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
|
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
| Resource type | Source | Notes/Reference |
|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
ASAP:ABE-0003107 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EcoCyc:EG10441 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10441 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
RegulonDB:ECK120000434 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB0436 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
| Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
|---|---|---|---|---|---|---|---|
|
Protein |
E. coli K-12 MC4100 |
2.11E+03 |
molecules/cell |
|
emPAI |
PMID:18304323 | |
|
Protein |
E. coli K-12 MG1655 |
15238 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
12357 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
9391 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
| edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
|
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
Figure courtesy of RegulonDB |
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:963031..963071
source=MG1655
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
| Allele Name | Mutation | Phenotype | Reference |
|---|---|---|---|
| edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
| Type | Reference | Notes |
|---|---|---|
|
microarray |
NCBI GEO profiles for ihfB | |
|
microarray |
Summary of data for ihfB from multiple microarray studies | |
| edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
| Resource Name | Resource Type | Description | Source | Notes |
|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions Related to ihfB Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG10441 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB0436 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10441 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120000434 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0003107 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
| Organism | Homologs (Statistics) | Comments |
|---|---|---|
|
Xenopus tropicalis |
|
From Inparanoid:20070104 |
|
Shigella flexneri |
HIMD |
From SHIGELLACYC |
|
E. coli O157 |
HIMD |
From ECOO157CYC |
| edit table |
Do-It-Yourself Web Tools
<protect></protect>
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG10441 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG10441 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120000434 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB0436 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0003107 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.0 1.1 1.2 1.3 Berlyn, MK (1998) Linkage map of Escherichia coli K-12, edition 10: the traditional map. Microbiol. Mol. Biol. Rev. 62 814-984 PubMed
- ↑ 2.0 2.1 2.2 2.3 2.4 2.5 2.6 2.7 2.8 2.9 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 3.2 3.3 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 5.0 5.1 5.2 5.3 5.4 5.5 5.6 5.7 5.8 5.9 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 6.0 6.1 6.2 CGSC: The Coli Genetics Stock Center
- ↑ 7.0 7.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
Categories


