{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

On One Page

Quickview |

Gene |

Product(s) |

Expression|

Evolution |

References |

Quickview

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Standard Name	ibpA
Gene Synonym(s)	ECK3679, b3687, JW3664, hslT, htpN^[1], htpN
Product Desc.	small heat shock protein IbpA^[2]^[3] Chaperone, heat-inducible protein of HSP20 family^[4]
Product Synonyms(s)	heat shock chaperone^[1], B3687^[2]^[1], HtpN^[2]^[1], HslT^[2]^[1], IbpA^[2]^[1] , ECK3679, hslT, htpN, JW3664, b3687
Function from GO	<GO_nr />
Knock-Out Phenotype
Regulation/Expression	transcription unit(s): ibpAB^[2], hslTS
Regulation/Activity
Quick Links
edit table

See Help:Quickview for help with entering information in the Quickview table.

Notes

[back to top]

RpoH regulon. 5' end has RNA thermosensor. Induced during biofilm formation.^[4]

Gene

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

[back to top]

See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name	ibpA
Mnemonic	Inclusion body protein
Synonyms	ECK3679, b3687, JW3664, hslT, htpN^[1], htpN
edit table

Notes

Location(s) and DNA Sequence

[back to top]

See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain	Map location	Genome coordinates	Genome browsers	Sequence links
MG1655	83.3 minutes	MG1655: 3865445..3865032 <gbrowseImage> name=NC_000913:3865032..3865445 source=MG1655 preset=GeneLocation </gbrowseImage>	EcoCyc GBrowse(MG1655)	FASTA Dump EcoCyc Sequence Dump
REL606		NC_012967: 3827783..3827370 <gbrowseImage> name=NC_012967:3827370..3827783 source=REL606 preset=GeneLocation </gbrowseImage>	GBrowse (REL606)	FASTA Dump
BW2952		NC_012759: 3753365..3753778 <gbrowseImage> name=NC_012759:3753365..3753778 source=BW2952 preset=GeneLocation </gbrowseImage>	GBrowse (BW2952)	FASTA Dump
W3110		W3110: 3772993..3773406 <gbrowseImage> name=NC_007779:3772993..3773406 source=W3110 preset=GeneLocation </gbrowseImage>	GBrowse(W3110)	FASTA Dump
DH10B		DH10B: 3963029..3962616 <gbrowseImage> name=NC_010473:3962616..3963029 source=DH10B preset=GeneLocation </gbrowseImage>	GBrowse(DH10B)	FASTA Dump
edit table

Notes

Sequence Features

[back to top]

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type	Strain	Genomic Location	Evidence	Reference	Notes
Coding Start (SO:0000323)	MG1655	3865032	Edman degradation	PMID:1356969
edit table

Notes

Alleles and Phenotypes

[back to top]

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele	Nt change(s)	AA change(s)	Reference	Availability
ΔibpA (Keio:JW3664)	deletion	deletion	PMID:16738554	Shigen CGSC10690^[5]
ΔibpA723::kan			PMID:16738554	CGSC:101516
edit table

Notes

Genetic Interactions

[back to top]

Interactor	Interaction	Allele	Score(s)	Reference(s)	Accessions	Notes
edit table

Notes

Genetic Resources

[back to top]

See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource	Resource Type	Source	Notes/Reference
JW3664	Plasmid clone	Shigen	PMID:16769691 Status:Clone OK Primer 1:GCCCGTAACTTTGATTTATCCCC Primer 2:CCGTTGATTTCGATACGGCGCGG
3D1	Kohara Phage	Genobase	PMID:3038334
8E8	Kohara Phage	Genobase	PMID:3038334
zic-4901::Tn10	Linked marker	CAG18492 = CGSC7457^[5]	est. P1 cotransduction: 21% ^[6]
zid-501::Tn10	Linked marker	CAG18499 = CGSC7458^[5]	est. P1 cotransduction: 73% ^[6]
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG11534	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG11534	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120001488	Escherichia coli str. K-12 substr. MG1655
NCBI (EcoliWiki Page)	GeneID:948200	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB1496	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0012058	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Product(s)

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name	IbpA
Synonyms	heat shock chaperone^[1], B3687^[2]^[1], HtpN^[2]^[1], HslT^[2]^[1], IbpA^[2]^[1] , ECK3679, hslT, htpN, JW3664, b3687
Product description	small heat shock protein IbpA^[2]^[3] Chaperone, heat-inducible protein of HSP20 family^[4]
EC number (for enzymes)
edit table

Notes

Function

[back to top]

Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier	GO ID	GO term name	Reference	Evidence Code	with/from	Aspect	Notes	Status
	GO:0005737	cytoplasm	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_02000	C	Seeded from EcoCyc (v14.0)	complete
	GO:0005737	cytoplasm	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0963	C	Seeded from EcoCyc (v14.0)	complete
	GO:0005737	cytoplasm	GO_REF:0000023	IEA: Inferred from Electronic Annotation	SP_SL:SL-0086	C	Seeded from EcoCyc (v14.0)	complete
	GO:0006950	response to stress	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0346	P	Seeded from EcoCyc (v14.0)	complete
	GO:0050821	protein stabilization	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_02000	P	Seeded from EcoCyc (v14.0)	complete
	GO:0009408	response to heat	PMID:8349564^[7]	IEP: Inferred from Expression Pattern		P		complete
edit table

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type	Partner	References	Evidence
Protein	add	PMID:15690043^[8]	Experiment(s):EBI-880023
Protein	atpD	PMID:15690043^[8]	Experiment(s):EBI-880023
Protein	clpA	PMID:15690043^[8]	Experiment(s):EBI-880023, EBI-885106
Protein	ftsZ	PMID:15690043^[8]	Experiment(s):EBI-880023
Protein	gadA	PMID:15690043^[8]	Experiment(s):EBI-880023
Protein	gatY	PMID:15690043^[8]	Experiment(s):EBI-880023
Protein	ibpB	PMID:15690043^[8]	Experiment(s):EBI-880023, EBI-885106, EBI-885226
Protein	malK	PMID:15690043^[8]	Experiment(s):EBI-880023, EBI-885106
Protein	malT	PMID:15690043^[8]	Experiment(s):EBI-880023
Protein	metK	PMID:15690043^[8]	Experiment(s):EBI-880023, EBI-885106
Protein	mreB	PMID:15690043^[8]	Experiment(s):EBI-880023, EBI-893751
Protein	ompC	PMID:15690043^[8]	Experiment(s):EBI-880023
Protein	pflB	PMID:15690043^[8]	Experiment(s):EBI-880023, EBI-885106
Protein	pnp	PMID:15690043^[8]	Experiment(s):EBI-880023, EBI-885106
Protein	pstB	PMID:15690043^[8]	Experiment(s):EBI-880023, EBI-885106
Protein	rpoB	PMID:15690043^[8]	Experiment(s):EBI-880023
Protein	rpoC	PMID:15690043^[8]	Experiment(s):EBI-880023
Protein	tufA	PMID:15690043^[8]	Experiment(s):EBI-880023, EBI-885106
Protein	yjjL	PMID:15690043^[8]	Experiment(s):EBI-880023
Protein	rpsF	PMID:15690043^[8]	Experiment(s):EBI-885106
Protein	rpsG	PMID:15690043^[8]	Experiment(s):EBI-885106
Protein	uspA	PMID:15690043^[8]	Experiment(s):EBI-885106
Protein	uspG	PMID:15690043^[8]	Experiment(s):EBI-885106
Protein	ybiY	PMID:15690043^[8]	Experiment(s):EBI-885106
Protein	cbpM	PMID:15690043^[8]	Experiment(s):EBI-885106
Protein	clpB	PMID:15690043^[8]	Experiment(s):EBI-885106
Protein	dnaJ	PMID:15690043^[8]	Experiment(s):EBI-885106
Protein	eno	PMID:15690043^[8]	Experiment(s):EBI-885106
Protein	gatA	PMID:15690043^[8]	Experiment(s):EBI-885106
Protein	gatB	PMID:15690043^[8]	Experiment(s):EBI-885106
Protein	gpmA	PMID:15690043^[8]	Experiment(s):EBI-885106
Protein	hrpB	PMID:15690043^[8]	Experiment(s):EBI-885106
Protein	infB	PMID:15690043^[8]	Experiment(s):EBI-885106
Protein	lpdA	PMID:15690043^[8]	Experiment(s):EBI-885106
Protein	malZ	PMID:15690043^[8]	Experiment(s):EBI-885106
Protein	msbB	PMID:15690043^[8]	Experiment(s):EBI-885106
Protein	prc	PMID:15690043^[8]	Experiment(s):EBI-885106
Protein	proS	PMID:15690043^[8]	Experiment(s):EBI-885106
Protein	radC	PMID:15690043^[8]	Experiment(s):EBI-885106
Protein	rpsA	PMID:15690043^[8]	Experiment(s):EBI-885106
Protein	rpsB	PMID:15690043^[8]	Experiment(s):EBI-885106
Protein	pflB	PMID:19402753^[9]	LCMS(ID Probability):99.0 MALDI(Z-score):17.053160
Protein	pnp	PMID:19402753^[9]	LCMS(ID Probability):99.0 MALDI(Z-score):17.053160
Protein	eno	PMID:19402753^[9]	LCMS(ID Probability):99.0
Protein	clpA	PMID:19402753^[9]	LCMS(ID Probability):99.0 MALDI(Z-score):17.053160
Protein	infB	PMID:19402753^[9]	LCMS(ID Probability):99.0
Protein	atpD	PMID:19402753^[9]	MALDI(Z-score):17.053160
Protein	uspG	PMID:19402753^[9]	LCMS(ID Probability):99.0
Protein	metK	PMID:19402753^[9]	LCMS(ID Probability):99.0 MALDI(Z-score):17.053160
Protein	uspA	PMID:19402753^[9]	LCMS(ID Probability):99.0
Protein	pstB	PMID:19402753^[9]	LCMS(ID Probability):99.0 MALDI(Z-score):17.053160
Protein	dnaJ	PMID:19402753^[9]	LCMS(ID Probability):99.0 MALDI(Z-score):2.708161
Protein	cbpM	PMID:19402753^[9]	LCMS(ID Probability):99.0
Protein	ftsZ	PMID:19402753^[9]	MALDI(Z-score):37.533852
Protein	gatB	PMID:19402753^[9]	LCMS(ID Probability):99.0
Protein	malZ	PMID:19402753^[9]	LCMS(ID Probability):99.0
Protein	yicR	PMID:19402753^[9]	LCMS(ID Probability):99.0
Protein	malT	PMID:19402753^[9]	MALDI(Z-score):17.702644
Protein	add	PMID:19402753^[9]	MALDI(Z-score):17.053160
Protein	gatY	PMID:19402753^[9]	MALDI(Z-score):17.053160
Protein	malK	PMID:19402753^[9]	LCMS(ID Probability):99.0 MALDI(Z-score):36.763598
Protein	ibpB	PMID:19402753^[9]	LCMS(ID Probability):99.0 MALDI(Z-score):38.694244
Protein	ybiY	PMID:19402753^[9]	LCMS(ID Probability):99.0
Protein	yjjL	PMID:19402753^[9]	MALDI(Z-score):17.053160
Protein	lpxM	PMID:19402753^[9]	LCMS(ID Probability):99.0
edit table

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment	Description	Evidence	Reference/Source	Notes
edit table

Notes

Structure and Physical Properties

[back to top]

Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence	at EcoCyc MRNFDLSPLY RSAIGFDRLF NHLENNQSQS NGGYPPYNVE LVDENHYRIA IAVAGFAESE LEITAQDNLL VVKGAHADEQ KERTYLYQGI AERNFERKFQ LAENIHVRGA NLVNGLLYID LERVIPEAKK PRRIEIN
Length	137
Mol. Wt	15.773 kDa
pI	5.7 (calculated)
Extinction coefficient	10,430 (calc based on 7 Y, 0 W, and 0 C residues)
edit table

Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type	Residues	Description	Notes	References
Domain	39..137	PF00011 Hsp20/alpha crystallin family		PMID:19920124^[10]
edit table

<motif_map/>

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=ibpA taxon=562,83333 </beststructure>

Models

View models at:

edit table

Structure figures

Notes

Gene Product Resources

[back to top]

See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type	Source	Notes/Reference
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
NCBI (Protein) (EcoliWiki Page)	GI:16131555	Escherichia coli str. K-12 substr. MG1655
NCBI (Protein) (EcoliWiki Page)	GeneID:948200	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0012058	Escherichia coli str. K-12 substr. MG1655
UniProt (EcoliWiki Page)	UniProtKB/Swiss-Prot:P0C054	Escherichia coli str. K-12 substr. MG1655
EcoCyc	EcoCyc:EG11534	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG11534	Escherichia coli str. K-12 substr. MG1655
NCBI (Gene) (EcoliWiki Page)	GeneID:948200	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120001488	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB1496	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Expression

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Cellular Levels

[back to top]

See Help:Cellular levels

Molecule	Organism or Strain	Value	Units	Experimental Conditions	Assay used	Notes	Reference(s)
Protein	E. coli K-12 MC4100	2.66E+03	molecules/cell	Medium: median data from rich and minimal media Temperature (°C): 37 Doubling time (min): Growth Rate(min): Growth phase: other:	emPAI		PMID:18304323
Protein	Ecoli K-12	217.956+/-2.625	Molecules/cell	Medium: Temperature (°C): Doubling time (min): Growth Rate(min): * Growth phase: other: *		Single Molecule Fluorescence	PMID:20671182
mRNA	Ecoli K-12	0.28592+/-0.01509	Molecules/cell	Medium: Temperature (°C): Doubling time (min): Growth Rate(min): * Growth phase: other: *		by FISH	PMID:20671182
Protein	E. coli K-12 MG1655	2834	molecules/cell/generation	Medium: MOPS Complete Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	666	molecules/cell/generation	Medium: MOPS Minimal Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	2032	molecules/cell/generation	Medium: MOPS Complete without Methionine Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
edit table

Notes

Transcription and Transcriptional Regulation

[back to top]

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)
ibpAB
edit table

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]

<gbrowseImage> name=NC_000913:3865425..3865465 source=MG1655 flip=1 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]

Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name	Mutation	Phenotype	Reference
edit table

Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type	Reference	Notes
microarray	GEO Profiles:b3687 (EcoliWiki Page)	NCBI GEO profiles for ibpA
microarray	GenExpDB:b3687 (EcoliWiki Page)	Summary of data for ibpA from multiple microarray studies
edit table

Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name	Resource Type	Description	Source	Notes
edit table

Notes

Accessions Related to ibpA Expression

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG11534	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB1496	Escherichia coli str. K-12 substr. MG1655
EcoliGenExpDB (EcoliWiki Page)	EcoliGenExpDB:b3687
EcoGene	EcoGene:EG11534	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120001488	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0012058	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Evolution

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]

See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism	Homologs (Statistics)	Comments
Anopheles gambiae	ENSANGP00000000082 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Shigella flexneri	IBPA	From SHIGELLACYC
E. coli O157	IBPA	From ECOO157CYC
edit table

Do-It-Yourself Web Tools

Notes

Families

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
Pfam (EcoliWiki Page)	PF00011 Hsp20/alpha crystallin family
Superfamily (EcoliWiki Page)	SUPERFAMILY:49764
Panther (EcoliWiki Page)	PTHR11527:SF15
EcoCyc	EcoCyc:EG11534	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG11534	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120001488	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB1496	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0012058	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

References

[back to top]

See Help:References for how to manage references in EcoliWiki.

↑ ^1.00 ^1.01 ^1.02 ^1.03 ^1.04 ^1.05 ^1.06 ^1.07 ^1.08 ^1.09 ^1.10 ^1.11 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
↑ ^2.00 ^2.01 ^2.02 ^2.03 ^2.04 ^2.05 ^2.06 ^2.07 ^2.08 ^2.09 ^2.10 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^3.0 ^3.1 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^4.0 ^4.1 ^4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
↑ ^5.0 ^5.1 ^5.2 CGSC: The Coli Genetics Stock Center
↑ ^6.0 ^6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
↑ Chuang, SE & Blattner, FR (1993) Characterization of twenty-six new heat shock genes of Escherichia coli. J. Bacteriol. 175 5242-52 PubMed
↑ ^8.00 ^8.01 ^8.02 ^8.03 ^8.04 ^8.05 ^8.06 ^8.07 ^8.08 ^8.09 ^8.10 ^8.11 ^8.12 ^8.13 ^8.14 ^8.15 ^8.16 ^8.17 ^8.18 ^8.19 ^8.20 ^8.21 ^8.22 ^8.23 ^8.24 ^8.25 ^8.26 ^8.27 ^8.28 ^8.29 ^8.30 ^8.31 ^8.32 ^8.33 ^8.34 ^8.35 ^8.36 ^8.37 ^8.38 ^8.39 ^8.40 Butland, G et al. (2005) Interaction network containing conserved and essential protein complexes in Escherichia coli. Nature 433 531-7 PubMed
↑ ^9.00 ^9.01 ^9.02 ^9.03 ^9.04 ^9.05 ^9.06 ^9.07 ^9.08 ^9.09 ^9.10 ^9.11 ^9.12 ^9.13 ^9.14 ^9.15 ^9.16 ^9.17 ^9.18 ^9.19 ^9.20 ^9.21 ^9.22 ^9.23 Hu, P et al. (2009) Global functional atlas of Escherichia coli encompassing previously uncharacterized proteins. PLoS Biol. 7 e96 PubMed
↑ Finn, RD et al. (2010) The Pfam protein families database. Nucleic Acids Res. 38 D211-22 PubMed

ibpA:On One Page

Quickview

Notes

Gene

Nomenclature

Notes

Location(s) and DNA Sequence

Notes

Sequence Features

Notes

Alleles and Phenotypes

Notes

Genetic Interactions

Notes

Genetic Resources

Notes

Accessions in Other Databases

Notes

Links

Product(s)

Nomenclature

Notes

Function

Notes

Localization

Notes

Structure and Physical Properties

Structure figures

Notes

Gene Product Resources

Notes

Accessions in Other Databases

Notes

Links

Expression

Overview

Cellular Levels

Notes

Transcription and Transcriptional Regulation

Notes

Translation and Regulation of Translation

Notes

Turnover and Regulation of Turnover

Notes

Experimental

Notes

Accessions Related to ibpA Expression

Notes

Links

Evolution

Homologs in Other Organisms

Do-It-Yourself Web Tools

Notes

Families

Notes

Links

References

Categories

Navigation menu

Search