hisF:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Standard Name |
hisF |
---|---|
Gene Synonym(s) |
ECK2020, b2025, JW2007[1], JW2007 |
Product Desc. |
imidazole glycerol phosphate synthase, HisF subunit[2][3]; Component of imidazole glycerol phosphate synthase[2][3] Cyclase component of imidazole glycerol phosphate (IGP) synthase[4] |
Product Synonyms(s) |
imidazole glycerol phosphate synthase, catalytic subunit with HisH[1], B2025[2][1], HisF[2][1], hisF enzyme[2][1] , ECK2020, JW2007, b2025 |
Function from GO |
<GO_nr /> |
Knock-Out Phenotype | |
Regulation/Expression |
transcription unit(s): hisBHAFI[2], hisLGDCBHAFI[2] |
Regulation/Activity | |
Quick Links | |
edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
N-terminus of purified HisF was sequenced by Klem and Davisson (1993), and the fMet is not clipped. Omitted from Verified set because natural RBS was not used. Natural RBS is very good and this is almost certainly the in vivo start.[4]
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Standard name |
hisF |
---|---|
Mnemonic |
Histidine |
Synonyms |
ECK2020, b2025, JW2007[1], JW2007 |
edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
---|---|---|---|---|
MG1655 |
45.13 minutes, 45.13 minutes |
MG1655: 2093868..2094644 |
||
NC_012967: 2025846..2026622 |
||||
NC_012759: 1986351..1987127 |
||||
W3110 |
|
W3110: 2097981..2098757 |
||
DH10B: 2184876..2185652 |
||||
edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
---|---|---|---|---|---|
edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
---|---|---|---|---|---|---|---|
ΔhisF (Keio:JW2007) |
deletion |
deletion |
Auxotrophies |
Requires histidine for growth |
PMID:16738554 |
||
hisFR5A |
R5A |
Auxotrophies |
Loss of activity |
seeded from UniProt:P60664 | |||
hisF::Tn5KAN-2 (FB20583) |
Insertion at nt 391 in Plus orientation |
Auxotrophies |
Requires Histidine for growth |
PMID:15262929 |
contains pKD46 | ||
hisFR5H |
R5H |
Auxotrophies |
Loss of IGP synthase activity. Weak IGP synthase activity and reduced hisH activity in vitro |
seeded from UniProt:P60664 | |||
hisFE46G |
E46G |
Auxotrophies |
Loss of IGP synthase activity. Weak IGP synthase and hisH activities in vitro |
seeded from UniProt:P60664 | |||
hisFQ123A |
Q123A |
Auxotrophies |
Decrease in activity |
seeded from UniProt:P60664 | |||
hisFQ123R |
Q123R |
Auxotrophies |
Loss of IGP synthase activity. Weak hisH activity in vitro |
seeded from UniProt:P60664 | |||
hisFC124A |
C124A |
Auxotrophies |
No change in activity |
seeded from UniProt:P60664 | |||
hisFC124R |
C124R |
Auxotrophies |
Loss of IGP synthase activity. Weak hisH activity in vitro |
seeded from UniProt:P60664 | |||
hisFE46A |
E46A |
Auxotrophies |
Loss of activity |
seeded from UniProt:P60664 | |||
hisF860(Stable) |
Auxotrophies |
Requires Histidine for growth |
|||||
hisF892 |
Auxotrophies |
Requires Histidine for growth |
|||||
ΔhisF723::kan |
deletion |
deletion |
Auxotrophies |
Requires Histidine for growth |
PMID:16738554 |
||
hisF852 |
Energy metabolism |
90% depletion of the ATP pool within 2 h of transfer to medium lacking histidine |
PMID:2644255 |
Strain TA5090 | |||
edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
---|---|---|---|---|---|---|
edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
Resource | Resource Type | Source | Notes/Reference |
---|---|---|---|
JW2007 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCCTGGCAAAACGCATAATCCC Primer 2:CCACATATCCTGATCTCCACGCC | |
Kohara Phage |
PMID:3038334 | ||
Kohara Phage |
PMID:3038334 | ||
zef-3129::Tn10 |
Linked marker |
est. P1 cotransduction: 69% [6] | |
Linked marker |
est. P1 cotransduction: % [6] | ||
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG10448 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10448 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120000441 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EchoBASE:EB0443 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0006727 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
Standard name |
HisF |
---|---|
Synonyms |
imidazole glycerol phosphate synthase, catalytic subunit with HisH[1], B2025[2][1], HisF[2][1], hisF enzyme[2][1] , ECK2020, JW2007, b2025 |
Product description |
imidazole glycerol phosphate synthase, HisF subunit[2][3]; Component of imidazole glycerol phosphate synthase[2][3] Cyclase component of imidazole glycerol phosphate (IGP) synthase[4] |
EC number (for enzymes) | |
edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
---|---|---|---|---|---|---|---|---|
GO:0000105 |
histidine biosynthetic process |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_01013 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0000105 |
histidine biosynthetic process |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR004651 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0000105 |
histidine biosynthetic process |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR006062 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0000105 |
histidine biosynthetic process |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0368 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0000107 |
imidazoleglycerol-phosphate synthase activity |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_01013 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0000107 |
imidazoleglycerol-phosphate synthase activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR004651 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016829 |
lyase activity |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0456 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
Partner Type | Partner | Notes | References | Evidence |
---|---|---|---|---|
Protein |
Subunits of imidazole glycerol phosphate synthase |
could be indirect |
| |
edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
Compartment | Description | Evidence | Reference/Source | Notes |
---|---|---|---|---|
edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
Name | |
---|---|
Sequence |
MLAKRIIPCL DVRDGQVVKG VQFRNHEIIG DIVPLAKRYA EEGADELVFY DITASSDGRV VDKSWVSRVA EVIDIPFCVA GGIKSLEDAA KILSFGADKI SINSPALADP TLITRLADRF GVQCIVVGID TWYDAETGKY HVNQYTGDES RTRVTQWETL DWVQEVQKRG AGEIVLNMMN QDGVRNGYDL EQLKKVREVC HVPLIASGGA GTMEHFLEAF RDADVDGALA ASVFHKQIIN IGELKAYLAT QGVEIRIC |
Length |
258 |
Mol. Wt |
28.453 kDa |
pI |
5.0 (calculated) |
Extinction coefficient |
32,430 - 33,055 (calc based on 7 Y, 4 W, and 5 C residues) |
edit table |
Domains/Motifs/Modification Sites
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
Resource type | Source | Notes/Reference |
---|---|---|
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
ASAP:ABE-0006727 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EcoCyc:EG10448 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10448 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
RegulonDB:ECK120000441 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB0443 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
---|---|---|---|---|---|---|---|
Protein |
E. coli K-12 MG1655 |
1002 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
989 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
494 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:2093848..2093888
source=MG1655
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
Allele Name | Mutation | Phenotype | Reference |
---|---|---|---|
edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
Type | Reference | Notes |
---|---|---|
microarray |
NCBI GEO profiles for hisF | |
microarray |
Summary of data for hisF from multiple microarray studies | |
edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
Resource Name | Resource Type | Description | Source | Notes |
---|---|---|---|---|
edit table |
<protect></protect>
Notes
Accessions Related to hisF Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG10448 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB0443 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10448 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120000441 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0006727 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
Organism | Homologs (Statistics) | Comments |
---|---|---|
Anopheles gambiae |
|
From Inparanoid:20070104 |
Saccharomyces cerevisiae |
|
From Inparanoid:20070104 |
Schizosaccharomyces pombe |
|
From Inparanoid:20070104 |
Shigella flexneri |
HISF |
From SHIGELLACYC |
E. coli O157 |
HISF |
From ECOO157CYC |
edit table |
Do-It-Yourself Web Tools
<protect></protect>
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG10448 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10448 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120000441 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB0443 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0006727 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 2.11 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 3.2 3.3 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
Categories