gloB:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
| Standard Name |
gloB |
|---|---|
| Gene Synonym(s) |
ECK0212, b0212, JW0202, yafR[1], yafR |
| Product Desc. |
Glyoxalase II, hydroxyacylglutathione hydrolase, Zn(2+) cofactor[4] |
| Product Synonyms(s) |
predicted hydroxyacylglutathione hydrolase[1], B0212[2][1], YafR[2][1], GloB[2][1] , ECK0212, JW0202, yafR, b0212 |
| Function from GO |
<GO_nr /> |
| Knock-Out Phenotype | |
| Regulation/Expression | |
| Regulation/Activity | |
| Quick Links | |
| edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
OtherPDB (S.typhimurium): 2QED.[4]
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
gloB |
|---|---|
| Mnemonic |
Glyoxalase |
| Synonyms |
ECK0212, b0212, JW0202, yafR[1], yafR |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
5.04 minutes |
MG1655: 234782..234027 |
||
|
NC_012967: 237706..236951 |
||||
|
NC_012759: 234026..234781 |
||||
|
W3110 |
|
W3110: 234782..234027 |
||
|
DH10B: 208886..208131 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
gloB(del) (Keio:JW0202) |
deletion |
deletion |
PMID:16738554 |
||||
|
gloB::Tn5KAN-I-SceI (FB20048) |
Insertion at nt 617 in Plus orientation |
PMID:15262929 |
does not contain pKD46 | ||||
|
gloB::Tn5KAN-I-SceI (FB20049) |
Insertion at nt 617 in Plus orientation |
PMID:15262929 |
contains pKD46 | ||||
|
gloB731(del)::kan |
PMID:16738554 |
| |||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0202 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCAATCTTAACAGTATTCCCGC Primer 2:CCGAACCTATCTTTCTTTGACCT | |
|
Kohara Phage |
PMID:3038334 | ||
|
Linked marker |
est. P1 cotransduction: 94% [6] | ||
|
Linked marker |
est. P1 cotransduction: 38% [6] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:G6099 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG13330 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
RegulonDB:ECK120002719 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB3114 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0000707 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
| Standard name |
GloB |
|---|---|
| Synonyms |
predicted hydroxyacylglutathione hydrolase[1], B0212[2][1], YafR[2][1], GloB[2][1] , ECK0212, JW0202, yafR, b0212 |
| Product description |
Glyoxalase II, hydroxyacylglutathione hydrolase, Zn(2+) cofactor[4] |
| EC number (for enzymes) |
|
| edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
| Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
|---|---|---|---|---|---|---|---|---|
|
GO:0004416 |
hydroxyacylglutathione hydrolase activity |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_01374 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0004416 |
hydroxyacylglutathione hydrolase activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR017782 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0004416 |
hydroxyacylglutathione hydrolase activity |
GOA:spec |
IEA: Inferred from Electronic Annotation |
EC:3.1.2.6 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0008270 |
zinc ion binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR017782 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0008270 |
zinc ion binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0862 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0046872 |
metal ion binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0479 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
| edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
| Partner Type | Partner | Notes | References | Evidence |
|---|---|---|---|---|
| edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
| Compartment | Description | Evidence | Reference/Source | Notes |
|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
| Name | |
|---|---|
| Sequence |
MNLNSIPAFD DNYIWVLNDE AGRCLIVDPG DAEPVLNAIA ANNWQPEAIF LTHHHHDHVG GVKELVEKFP QIVVYGPQET QDKGTTQVVK DGETAFVLGH EFSVIATPGH TLGHICYFSK PYLFCGDTLF SGGCGRLFEG TASQMYQSLK KLSALPDDTL VCCAHEYTLS NMKFALSILP HDLSINDYYR KVKELRAKNQ ITLPVILKNE RQINVFLRTE DIDLINVINE ETLLQQPEER FAWLRSKKDR F |
| Length |
251 |
| Mol. Wt |
28.434 kDa |
| pI |
5.6 (calculated) |
| Extinction coefficient |
28,420 - 29,170 (calc based on 8 Y, 3 W, and 6 C residues) |
| edit table |
Domains/Motifs/Modification Sites
|
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
|
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
| Resource type | Source | Notes/Reference |
|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
ASAP:ABE-0000707 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EcoCyc:G6099 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG13330 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
RegulonDB:ECK120002719 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB3114 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
| Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
|---|---|---|---|---|---|---|---|
|
Protein |
Ecoli K-12 |
7.29+/-0.066 |
Molecules/cell |
|
Single Molecule Fluorescence |
PMID:20671182 | |
|
mRNA |
Ecoli K-12 |
0.042384106 |
Molecules/cell |
|
by RNA_Seq |
PMID:20671182 | |
|
Protein |
E. coli K-12 MG1655 |
390 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
401 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
347 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
| edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
|
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
Figure courtesy of RegulonDB |
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:234762..234802
source=MG1655
flip=1
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
| Allele Name | Mutation | Phenotype | Reference |
|---|---|---|---|
| edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
| Type | Reference | Notes |
|---|---|---|
|
microarray |
NCBI GEO profiles for gloB | |
|
microarray |
Summary of data for gloB from multiple microarray studies | |
| edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
| Resource Name | Resource Type | Description | Source | Notes |
|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions Related to gloB Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:G6099 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB3114 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG13330 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120002719 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0000707 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
| Organism | Homologs (Statistics) | Comments |
|---|---|---|
|
Anopheles gambiae |
|
From Inparanoid:20070104 |
|
Apis mellifera |
|
From Inparanoid:20070104 |
|
Arabidopsis thaliana |
|
From Inparanoid:20070104 |
|
Bos taurus |
|
From Inparanoid:20070104 |
|
Caenorhabditis briggsae |
|
From Inparanoid:20070104 |
|
Caenorhabditis elegans |
|
From Inparanoid:20070104 |
|
Canis familiaris |
|
From Inparanoid:20070104 |
|
Ciona intestinalis |
|
From Inparanoid:20070104 |
|
Danio rerio |
|
From Inparanoid:20070104 |
|
Dictyostelium discoideum |
|
From Inparanoid:20070104 |
|
Drosophila melanogaster |
|
From Inparanoid:20070104 |
|
Drosophila pseudoobscura |
|
From Inparanoid:20070104 |
|
Gallus gallus |
|
From Inparanoid:20070104 |
|
Homo sapiens |
|
From Inparanoid:20070104 |
|
Macaca mulatta |
|
From Inparanoid:20070104 |
|
Monodelphis domestica |
|
From Inparanoid:20070104 |
|
Mus musculus |
|
From Inparanoid:20070104 |
|
Oryza gramene |
|
From Inparanoid:20070104 |
|
Pan troglodytes |
|
From Inparanoid:20070104 |
|
Rattus norvegicus |
|
From Inparanoid:20070104 |
|
Saccharomyces cerevisiae |
|
From Inparanoid:20070104 |
|
Schizosaccharomyces pombe |
|
From Inparanoid:20070104 |
|
Takifugu rubripes |
|
From Inparanoid:20070104 |
|
Tetraodon nigroviridis |
|
From Inparanoid:20070104 |
|
Xenopus tropicalis |
|
From Inparanoid:20070104 |
|
Shigella flexneri |
GLOB |
From SHIGELLACYC |
|
E. coli O157 |
GLOB |
From ECOO157CYC |
| edit table |
Do-It-Yourself Web Tools
<protect></protect>
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:G6099 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG13330 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120002719 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB3114 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0000707 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8 1.9 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 2.2 2.3 2.4 2.5 2.6 2.7 2.8 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
Categories
- Genes with homologs in Anopheles gambiae
- Genes with homologs in Apis mellifera
- Genes with homologs in Arabidopsis thaliana
- Genes with homologs in Bos taurus
- Genes with homologs in Caenorhabditis briggsae
- Genes with homologs in Caenorhabditis elegans
- Genes with homologs in Canis familiaris
- Genes with homologs in Ciona intestinalis
- Genes with homologs in Danio rerio
- Genes with homologs in Dictyostelium discoideum
- Genes with homologs in Drosophila melanogaster
- Genes with homologs in Drosophila pseudoobscura
- Genes with homologs in Gallus gallus
- Genes with homologs in Homo sapiens
- Genes with homologs in Macaca mulatta
- Genes with homologs in Monodelphis domestica
- Genes with homologs in Mus musculus
- Genes with homologs in Oryza gramene
- Genes with homologs in Pan troglodytes
- Genes with homologs in Rattus norvegicus
- Genes with homologs in Saccharomyces cerevisiae
- Genes with homologs in Schizosaccharomyces pombe
- Genes with homologs in Takifugu rubripes
- Genes with homologs in Tetraodon nigroviridis
- Genes with homologs in Xenopus tropicalis
- Genes with homologs in Shigella flexneri
- Genes with homologs in E. coli O157


