ftsZ:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
ftsZ |
|---|---|
| Mnemonic |
Filamentation, temperature sensitive |
| Synonyms |
ECK0096, b0095, JW0093, sfiB, sulB[1], sulB |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
2.27 minutes |
MG1655: 105305..106456 |
||
|
NC_012967: 108109..109260 |
||||
|
NC_012759: 105304..106455 |
||||
|
W3110 |
|
W3110: 105305..106456 |
||
|
DH10B: 79409..80560 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
105305 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ftsZG105F |
G105F |
In ftsZ-84; loss of GTPase-activity and conversion to an ATPase |
seeded from UniProt:P0A9A6 | ||||
|
ftsZT108A |
T108A |
In ftsZ-Z3; lethal; greatly reduced GTP binding |
seeded from UniProt:P0A9A6 | ||||
|
ftsZ844(ts) |
temperature sensitive |
||||||
|
ftsZ26(ts) |
Growth Phenotype |
cell division is blocked and filaments with smooth morphology are formed abnormal geometry of z ring is formed |
unable to localize FtsZ at non-permissive temp. at permissive temp. cells have altered polar morphology | ||||
|
ftsZ25(ts) |
temperature sensitive |
||||||
|
ftsZ103 |
TTC to TGC |
Phe to Cys at amino acid 268 |
Resistant to |
resistant to SulA |
same phenotype as ftsZ114 | ||
|
ftsZ1 |
GCT to ACT |
Ala to Thr at amino acid 70 |
Resistant to |
resistant to SulA |
|||
|
ftsZ9 |
Insertion of TC GGC G |
Insertion of Val-Gly after amino acid 18 |
Resistant to |
resistant to SulA |
same phenotype as ftsZ25 | ||
|
ftsZ100 |
GCT to GTT and TTC to TGC |
Ala to Val at amino acid 81 and Phe to Cys at amino acid 268 |
Resistant to |
resistant to SulA and partially resistant to minCD |
participates in cell division regardless of SulA’s presence
| ||
|
ftsZ114 |
reduced affinity for SulA |
previously known as sfiB114 | |||||
|
ftsZ3 |
ACC to GAC |
Thr to Ala at amino acid 108 |
Resistant to |
resistant to SulA |
unstable protein, unable to support cell growth and shows a deficiency in GTP interaction | ||
|
ftsZ2 |
Growth Phenotype |
reduces the activity of ftsZ, forms elongated nucleated cells with minicells |
resistant to SulA's effect, but still shown to interact with it based on 2 Hybrid screen. displays reduced GTP hydrolysis but is able to support cell growth | ||||
|
ftsZ84 |
Cell Shape |
unable to form Z-ring at non-permissive temperature |
reduced GTPase activity and a reduced ability to polymerize | ||||
|
ftsZ84 |
missense mutation |
Growth Phenotype |
at non-permissive temperature cell division is blocked and filaments with smooth morphology are formed |
changed GTPase activity to ATPase activity instead | |||
|
ftsZ2 |
GAC to GGC |
Asp to Gly at amino acid 212 |
Resistant to |
resistant to SulA |
|||
|
ftsZ84 |
GGT to AGT |
Gly to Ser at amino acid 105 |
Growth Phenotype |
temperature sensitive |
| ||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0093 |
Plasmid clone |
Status:Clone OK Primer 1:GCCTTTGAACCAATGGAACTTAC Primer 2:CCATCAGCTTGCTTACGCAGGAA | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
leuO3051::Tn10 |
Linked marker |
est. P1 cotransduction: 45% [20] | |
|
Linked marker |
est. P1 cotransduction: 15% [20] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Link, AJ et al. (1997) Comparing the predicted and observed properties of proteins encoded in the genome of Escherichia coli K-12. Electrophoresis 18 1259-313 PubMed
- ↑ Lutkenhaus, JF et al. (1980) Organization of genes in the ftsA-envA region of the Escherichia coli genetic map and identification of a new fts locus (ftsZ). J. Bacteriol. 142 615-20 PubMed
- ↑ Ricard, M & Hirota, Y (1973) Process of cellular division in Escherichia coli: physiological study on thermosensitive mutants defective in cell division. J. Bacteriol. 116 314-22 PubMed
- ↑ 5.0 5.1 Bi, E & Lutkenhaus, J (1992) Isolation and characterization of ftsZ alleles that affect septal morphology. J. Bacteriol. 174 5414-23 PubMed
- ↑ 6.0 6.1 6.2 Addinall, SG et al. (1996) FtsZ ring formation in fts mutants. J. Bacteriol. 178 3877-84 PubMed
- ↑ Huisman, O & D'Ari, R (1981) An inducible DNA replication-cell division coupling mechanism in E. coli. Nature 290 797-9 PubMed
- ↑ George, J et al. (1975) Prophage induction and cell division in E. coli. III. Mutations sfiA and sfiB restore division in tif and lon strains and permit the expression of mutator properties of tif. Mol. Gen. Genet. 140 309-332 PubMed
- ↑ 9.0 9.1 9.2 9.3 9.4 9.5 9.6 Bi, E & Lutkenhaus, J (1990) Analysis of ftsZ mutations that confer resistance to the cell division inhibitor SulA (SfiA). J. Bacteriol. 172 5602-9 PubMed
- ↑ 10.0 10.1 10.2 10.3 10.4 10.5 Huang, J et al. (1996) Interaction between FtsZ and inhibitors of cell division. J. Bacteriol. 178 5080-5 PubMed
- ↑ Pichoff, S & Lutkenhaus, J (2001) Escherichia coli division inhibitor MinCD blocks septation by preventing Z-ring formation. J. Bacteriol. 183 6630-5 PubMed
- ↑ Mukherjee, A et al. (1998) Inhibition of FtsZ polymerization by SulA, an inhibitor of septation in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 95 2885-90 PubMed
- ↑ Jones, CA & Holland, IB (1984) Inactivation of essential division genes, ftsA, ftsZ, suppresses mutations at sfiB, a locus mediating division inhibition during the SOS response in E. coli. EMBO J. 3 1181-6 PubMed
- ↑ RayChaudhuri, D & Park, JT (1992) Escherichia coli cell-division gene ftsZ encodes a novel GTP-binding protein. Nature 359 251-4 PubMed
- ↑ Bramhill, D & Thompson, CM (1994) GTP-dependent polymerization of Escherichia coli FtsZ protein to form tubules. Proc. Natl. Acad. Sci. U.S.A. 91 5813-7 PubMed
- ↑ RayChaudhuri, D & Park, JT (1994) A point mutation converts Escherichia coli FtsZ septation GTPase to an ATPase. J. Biol. Chem. 269 22941-4 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 18.0 18.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 19.0 19.1 CGSC: The Coli Genetics Stock Center
- ↑ 20.0 20.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
