fliA:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Standard Name |
fliA |
---|---|
Gene Synonym(s) |
ECK1921, b1922, JW1907, flaD, rpoF[1], rpoF |
Product Desc. |
sigma28 factor[2]; RNA polymerase, sigma 28 (sigma F) factor[3]; Component of RNA polymerase sigma 28[3] Transcription factor sigma 28 for class III flagellar operons[4] |
Product Synonyms(s) |
RNA polymerase, sigma 28 (sigma F) factor[1], B1922[2][1], RpoF[2][1], FlaD[2][1], FliA[2][1], sigmaF factor[2][1], sigma F factor[3][1], sigma 28 factor[3][1] , ECK1921, flaD, JW1907, rpoF, b1922 |
Function from GO |
<GO_nr /> |
Knock-Out Phenotype | |
Regulation/Expression | |
Regulation/Activity | |
Quick Links | |
edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Standard name |
fliA |
---|---|
Mnemonic |
Flagella |
Synonyms |
ECK1921, b1922, JW1907, flaD, rpoF[1], rpoF |
edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
---|---|---|---|---|
MG1655 |
43.09 minutes |
MG1655: 1999813..1999094 |
||
NC_012759: 1891577..1892296 |
||||
W3110 |
|
W3110: 2003926..2003207 |
||
DH10B: 2090821..2090102 |
||||
edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
---|---|---|---|---|---|
edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
---|---|---|---|---|---|---|---|
ΔfliA (Keio:JW1907) |
deletion |
deletion |
PMID:16738554 |
||||
fliA::Tn5KAN-2 (FB20526) |
Insertion at nt 154 in Minus orientation |
PMID:15262929 |
does not contain pKD46 | ||||
fliA::Tn5KAN-2 (FB20527) |
Insertion at nt 154 in Minus orientation |
PMID:15262929 |
contains pKD46 | ||||
edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
---|---|---|---|---|---|---|
edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
Resource | Resource Type | Source | Notes/Reference |
---|---|---|---|
JW1907 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCAATTCACTCTATACCGCTGA Primer 2:CCTAACTTACCCAGTTTAGTGCG | |
Kohara Phage |
PMID:3038334 | ||
Kohara Phage |
PMID:3038334 | ||
Linked marker |
est. P1 cotransduction: 74% [6] | ||
Linked marker |
est. P1 cotransduction: 21% [6] | ||
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG11355 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG11355 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120001324 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EchoBASE:EB1330 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0006396 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
Standard name |
FliA |
---|---|
Synonyms |
RNA polymerase, sigma 28 (sigma F) factor[1], B1922[2][1], RpoF[2][1], FlaD[2][1], FliA[2][1], sigmaF factor[2][1], sigma F factor[3][1], sigma 28 factor[3][1] , ECK1921, flaD, JW1907, rpoF, b1922 |
Product description |
sigma28 factor[2]; RNA polymerase, sigma 28 (sigma F) factor[3]; Component of RNA polymerase sigma 28[3] Transcription factor sigma 28 for class III flagellar operons[4] |
EC number (for enzymes) |
|
edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
---|---|---|---|---|---|---|---|---|
GO:0003677 |
DNA binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000943 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0003677 |
DNA binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR007624 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0003677 |
DNA binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR007627 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0003677 |
DNA binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR007630 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0003677 |
DNA binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR012845 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0003677 |
DNA binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR013324 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0003677 |
DNA binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR013325 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0003677 |
DNA binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR014284 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0003677 |
DNA binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0238 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0003700 |
transcription factor activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000943 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0003700 |
transcription factor activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR007624 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0003700 |
transcription factor activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR007627 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0003700 |
transcription factor activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR007630 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0003700 |
transcription factor activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR013324 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0003700 |
transcription factor activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR013325 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0003700 |
transcription factor activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR014284 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0003899 |
DNA-directed RNA polymerase activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR012845 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006350 |
transcription |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0804 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006352 |
transcription initiation |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000943 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006352 |
transcription initiation |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR007624 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006352 |
transcription initiation |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR007627 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006352 |
transcription initiation |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR007630 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006352 |
transcription initiation |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR012845 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006352 |
transcription initiation |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR013324 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006352 |
transcription initiation |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR013325 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006352 |
transcription initiation |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR014284 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006355 |
regulation of transcription, DNA-dependent |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000943 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006355 |
regulation of transcription, DNA-dependent |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR007624 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006355 |
regulation of transcription, DNA-dependent |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR007627 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006355 |
regulation of transcription, DNA-dependent |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR007630 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006355 |
regulation of transcription, DNA-dependent |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR013324 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006355 |
regulation of transcription, DNA-dependent |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR013325 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006355 |
regulation of transcription, DNA-dependent |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR014284 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006355 |
regulation of transcription, DNA-dependent |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0731 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016987 |
sigma factor activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR000943 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016987 |
sigma factor activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR007624 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016987 |
sigma factor activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR007627 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016987 |
sigma factor activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR007630 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016987 |
sigma factor activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR012845 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016987 |
sigma factor activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR013324 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016987 |
sigma factor activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR013325 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016987 |
sigma factor activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR014284 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016987 |
sigma factor activity |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0731 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0045449 |
regulation of transcription |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR012845 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0045449 |
regulation of transcription |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0805 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
Partner Type | Partner | Notes | References | Evidence |
---|---|---|---|---|
Protein |
Subunits of RNA polymerase sigma 28 |
could be indirect |
||
Protein |
rpsC |
PMID:16606699 |
Experiment(s):EBI-1141347 | |
Protein |
yagS |
PMID:16606699 |
Experiment(s):EBI-1141347 | |
Protein |
cusA |
PMID:16606699 |
Experiment(s):EBI-1141347 | |
Protein |
rpoB |
PMID:16606699 |
Experiment(s):EBI-1141347 | |
Protein |
csgD |
PMID:16606699 |
Experiment(s):EBI-1141347 | |
Protein |
yafJ |
PMID:16606699 |
Experiment(s):EBI-1141347 | |
Protein |
rpoC |
PMID:16606699 |
Experiment(s):EBI-1141347 | |
Protein |
ygcF |
PMID:16606699 |
Experiment(s):EBI-1141347 | |
Protein |
rpoA |
PMID:16606699 |
Experiment(s):EBI-1141347 | |
Protein |
infB |
PMID:16606699 |
Experiment(s):EBI-1141347 | |
edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
Compartment | Description | Evidence | Reference/Source | Notes |
---|---|---|---|---|
edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
Name | |
---|---|
Sequence |
MNSLYTAEGV MDKHSLWQRY VPLVRHEALR LQVRLPASVE LDDLLQAGGI GLLNAVERYD ALQGTAFTTY AVQRIRGAML DELRSRDWVP RSVRRNAREV AQAIGQLEQE LGRNATETEV AERLGIDIAD YRQMLLDTNN SQLFSYDEWR EEHGDSIELV TDDHQRENPL QQLLDSNLRQ RVMEAIETLP EREKLVLTLY YQEELNLKEI GAVLEVGESR VSQLHSQAIK RLRTKLGKL |
Length |
239 |
Mol. Wt |
27.521 kDa |
pI |
5.1 (calculated) |
Extinction coefficient |
28,420 (calc based on 8 Y, 3 W, and 0 C residues) |
edit table |
Domains/Motifs/Modification Sites
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
Resource type | Source | Notes/Reference |
---|---|---|
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
ASAP:ABE-0006396 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EcoCyc:EG11355 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG11355 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
RegulonDB:ECK120001324 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB1330 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
---|---|---|---|---|---|---|---|
Protein |
E. coli K-12 MG1655 |
40 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
9 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
0a |
molecules/cell/generation |
|
Ribosome Profiling |
Low confidence in the sequencing data set. |
PMID: 24766808 |
edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:1999793..1999833
source=MG1655
flip=1
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
Allele Name | Mutation | Phenotype | Reference |
---|---|---|---|
edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
Type | Reference | Notes |
---|---|---|
microarray |
NCBI GEO profiles for fliA | |
microarray |
Summary of data for fliA from multiple microarray studies | |
edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
Resource Name | Resource Type | Description | Source | Notes |
---|---|---|---|---|
GFP Fusion |
Intergenic region (1999740..2000183) fused to gfpmut2. |
GFP fusion described in Zaslaver, et al. | ||
edit table |
<protect></protect>
Notes
Accessions Related to fliA Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG11355 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB1330 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG11355 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120001324 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0006396 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
Organism | Homologs (Statistics) | Comments |
---|---|---|
Anopheles gambiae |
|
From Inparanoid:20070104 |
Xenopus tropicalis |
|
From Inparanoid:20070104 |
E. coli O157 |
FLIA |
From ECOO157CYC |
edit table |
Do-It-Yourself Web Tools
<protect></protect>
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG11355 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG11355 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120001324 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB1330 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0006396 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 2.11 2.12 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 3.2 3.3 3.4 3.5 3.6 3.7 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 5.0 5.1 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed
Categories