flgF:On One Page

From EcoliWiki
Jump to: navigation, search

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Quickview | Gene | Product(s) | Expression| Evolution | References |

Quickview

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

<protect>

Standard Name

flgF

Gene Synonym(s)

ECK1062, b1077, JW1064, flaX, fla FVI, fla, F, FVI[1][2]

Product Desc.

flagellar basal-body rod protein FlgF[2][3];

Component of Flagellar Motor Complex[2][3]; Flagellum[3]

Flagellar basal body rod subunit[4]

Product Synonyms(s)

flagellar component of cell-proximal portion of basal-body rod[1], B1077[2][1], Fla[2][1], FlaX[2][1], FlgF[2][1] , ECK1062, flaX, JW1064, b1077

Function from GO

<GO_nr />

Knock-Out Phenotype
Regulation/Expression

transcription unit(s): flgBCDEFGHIJ[2]

Regulation/Activity
Quick Links

porteco.png EcoCyc.gif regulondb.jpg

dnadisplay.png proteindisplay.png   pubmed.jpg   textpresso.jpg  

</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>

Notes

[back to top]


Overexpression causes mucoidy, decreases the amount of biofilm formed, and prevents flagella formation. Flagellar regulon.[4]



Gene

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css> <protect>

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

flgF

Mnemonic

Flagella

Synonyms

ECK1062, b1077, JW1064, flaX, fla FVI, fla, F, FVI[1][2]

</protect>

Notes

Location(s) and DNA Sequence

[back to top]


<protect> See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

24.42 minutes 

MG1655: 1133025..1133780
<gbrowseImage> name=NC_000913:1133025..1133780 source=MG1655 preset=GeneLocation </gbrowseImage>

REL606

NC_012967: 1148371..1149126
<gbrowseImage> name=NC_012967:1148371..1149126 source=REL606 preset=GeneLocation </gbrowseImage>

BW2952

NC_012759: 1036950..1037705
<gbrowseImage> name=NC_012759:1036950..1037705 source=BW2952 preset=GeneLocation </gbrowseImage>

W3110

 

W3110: 1135379..1136134
<gbrowseImage> name=NC_007779:1135379..1136134 source=W3110 preset=GeneLocation </gbrowseImage>

DH10B

DH10B: 1188470..1189225
<gbrowseImage> name=NC_010473:1188470..1189225 source=DH10B preset=GeneLocation </gbrowseImage>

</protect>

Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

<protect></protect>

Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

ΔflgF (Keio:JW1064)

deletion

deletion

PMID:16738554

Shigen
CGSC9021[5]

flgF::Tn5KAN-2 (FB20097)

Insertion at nt 138 in Plus orientation

PMID:15262929

E. coli Genome Project:FB20097

does not contain pKD46

ΔflgF746::kan

PMID:16738554

CGSC:100908


<protect></protect>

Notes

Genetic Interactions

[back to top]


<protect>

Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

</protect>

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW1064

Plasmid clone

Shigen

PMID:16769691

Status:Clone OK

Primer 1:GCCGATCACGCAATTTATACCGC

Primer 2:CCACTCATCGACAGCAGTTGGTT

E3G11

Kohara Phage

Genobase

PMID:3038334

zcc-282::Tn10

Linked marker

CAG18466 = CGSC7359[5]

est. P1 cotransduction: 1% [6]

zce-726::Tn10

Linked marker

CAG12078 = CGSC7361[5]

est. P1 cotransduction: 44% [6]

<protect></protect>

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:G362

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG14270

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120002684

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:945639

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB4018

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0003649

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]



Product(s)

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name

FlgF

Synonyms

flagellar component of cell-proximal portion of basal-body rod[1], B1077[2][1], Fla[2][1], FlaX[2][1], FlgF[2][1] , ECK1062, flaX, JW1064, b1077

Product description

flagellar basal-body rod protein FlgF[2][3];

Component of Flagellar Motor Complex[2][3]; Flagellum[3]

Flagellar basal body rod subunit[4]

EC number (for enzymes)


<protect></protect>

Notes

Function

[back to top]


<protect> Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier GO ID GO term name Reference Evidence Code with/from Aspect Notes Status

GO:0001539

ciliary or flagellar motility

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR001444

P

Seeded from EcoCyc (v14.0)

complete

GO:0001539

ciliary or flagellar motility

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR019776

P

Seeded from EcoCyc (v14.0)

complete

GO:0003774

motor activity

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR001444

F

Seeded from EcoCyc (v14.0)

complete

GO:0003774

motor activity

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR019776

F

Seeded from EcoCyc (v14.0)

complete

GO:0005198

structural molecule activity

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR001444

F

Seeded from EcoCyc (v14.0)

complete

GO:0005198

structural molecule activity

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR019776

F

Seeded from EcoCyc (v14.0)

complete

GO:0006928

cellular component movement

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR012836

P

Seeded from EcoCyc (v14.0)

complete

GO:0009288

bacterial-type flagellum

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR001444

C

Seeded from EcoCyc (v14.0)

complete

GO:0009288

bacterial-type flagellum

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR019776

C

Seeded from EcoCyc (v14.0)

complete

GO:0009288

bacterial-type flagellum

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0975

C

Seeded from EcoCyc (v14.0)

complete

GO:0009425

bacterial-type flagellum basal body

GO_REF:0000023

IEA: Inferred from Electronic Annotation

SP_SL:SL-0142

C

Seeded from EcoCyc (v14.0)

complete

GO:0019861

flagellum

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR010930

C

Seeded from EcoCyc (v14.0)

complete

GO:0043064

flagellum organization

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR012836

P

Seeded from EcoCyc (v14.0)

complete

GO:0044461

bacterial-type flagellum part

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR012836

C

Seeded from EcoCyc (v14.0)

complete

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type Partner Notes References Evidence

Protein

Subunits of Flagellar Motor Complex

could be indirect

Protein

dnaK

PMID:16606699

Experiment(s):EBI-1138778

Protein

djlA

PMID:16606699

Experiment(s):EBI-1138778

Protein

nadE

PMID:16606699

Experiment(s):EBI-1138778

Protein

Subunits of Flagellum

could be indirect


</protect>

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment Description Evidence Reference/Source Notes

Periplasm

PMID:12730325

EchoLocation:flgF


<protect></protect>

Notes

Structure and Physical Properties

[back to top]


<protect> Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence

at EcoCyc

MDHAIYTAMG AASQTLNQQA VTASNLANAS TPGFRAQLNA LRAVPVEGLS LPTRTLVTAS
TPGADMTPGK MDYTSRPLDV ALQQDGWLAV QTADGSEGYT RNGSIQVDPT GQLTIQGHPV
IGEAGPIAVP EGAEITIAAD GTISALNPGD PANTVAPVGR LKLVKATGSE VQRGDDGIFR
LSAETQATRG PVLQADPTLR VMSGVLEGSN VNAVAAMSDM IASARRFEMQ MKVISSVDDN
AGRANQLLSM S
Length

251

Mol. Wt

25.911 kDa

pI

4.7 (calculated)

Extinction coefficient

9,970 (calc based on 3 Y, 1 W, and 0 C residues)


Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type Residues Description Notes References

Domain

5..35

PF00460 Flagella basal body rod protein

PMID:19920124

Domain

209..247

PF06429 Domain of unknown function (DUF1078)

PMID:19920124

<motif_map/>

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=flgF taxon=562,83333 </beststructure>

Models

View models at:

</protect>

Structure figures

<protect>

</protect>

Notes

Gene Product Resources

[back to top]


See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type Source Notes/Reference

<protect></protect>

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

NCBI (Protein) (EcoliWiki Page)

GI:16129040

Escherichia coli str. K-12 substr. MG1655

NCBI (Protein) (EcoliWiki Page)

GeneID:945639

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0003649

Escherichia coli str. K-12 substr. MG1655

UniProt (EcoliWiki Page)

UniProtKB/Swiss-Prot:P75938

Escherichia coli str. K-12 substr. MG1655

EcoCyc

EcoCyc:G362

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG14270

Escherichia coli str. K-12 substr. MG1655

NCBI (Gene) (EcoliWiki Page)

GeneID:945639

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120002684

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB4018

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]




Expression

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.


Cellular Levels

[back to top]


See Help:Cellular levels

Molecule Organism or Strain Value Units Experimental Conditions Assay used Notes Reference(s)

Protein

E. coli K-12 MG1655

44

molecules/cell/generation

  • Medium: MOPS Complete
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Protein

E. coli K-12 MG1655

11

molecules/cell/generation

  • Medium: MOPS Minimal
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Protein

E. coli K-12 MG1655

0a

molecules/cell/generation

  • Medium: MOPS Complete without Methionine
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

Low confidence in the sequencing data set.

PMID: 24766808

Notes

Transcription and Transcriptional Regulation

[back to top]


<protect>

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)

flgBCDEFGHIJ

Figure courtesy of RegulonDB

</protect>

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]


<protect><gbrowseImage> name=NC_000913:1133005..1133045 source=MG1655 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

</protect>

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]


<protect> Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name Mutation Phenotype Reference


Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type Reference Notes

microarray

GEO Profiles:b1077 (EcoliWiki Page)

NCBI GEO profiles for flgF

microarray

GenExpDB:b1077 (EcoliWiki Page)

Summary of data for flgF from multiple microarray studies


Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name Resource Type Description Source Notes

<protect></protect>

Notes

Accessions Related to flgF Expression

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:G362

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB4018

Escherichia coli str. K-12 substr. MG1655

EcoliGenExpDB (EcoliWiki Page)

EcoliGenExpDB:b1077

EcoGene

EcoGene:EG14270

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120002684

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0003649

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]



Evolution

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]


See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism Homologs (Statistics) Comments

Anopheles gambiae

  • ENSANGP00000026115 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Xenopus tropicalis

  • ENSXETP00000014117 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

E. coli O157

FLGF

From ECOO157CYC


Do-It-Yourself Web Tools

<protect></protect>

Notes

Families

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

Pfam (EcoliWiki Page)

PF00460 Flagella basal body rod protein

Superfamily (EcoliWiki Page)

SUPERFAMILY:117143

Pfam (EcoliWiki Page)

PF06429 Domain of unknown function (DUF1078)

EcoCyc

EcoCyc:G362

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG14270

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120002684

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB4018

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0003649

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]



References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 2.11 2.12 2.13 2.14 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  3. 3.0 3.1 3.2 3.3 3.4 3.5 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  4. 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
  5. 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
  6. 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories

[back to top]