envC:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
envC |
|---|---|
| Mnemonic |
Envelope |
| Synonyms | |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
81.58 minutes |
MG1655: 3784861..3786120 |
||
|
NC_012967: 3727604..3728863 |
||||
|
NC_012759: 3673187..3674446 |
||||
|
W3110 |
|
W3110: 3853577..3852318 |
||
|
DH10B: 3882438..3883697 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔenvC (Keio:JW5646) |
deletion |
deletion |
|||||
|
yibP::Tn5KAN-2 (FB21343) |
Insertion at nt 1087 in Plus orientation |
does not contain pKD46 | |||||
|
yibP::Tn5KAN-2 (FB21344) |
Insertion at nt 1087 in Plus orientation |
contains pKD46 | |||||
|
ΔyibP::kan |
deletion |
Biolog:respiration |
unable to respire Acetate |
||||
|
ΔyibP::kan |
deletion |
Biolog:respiration |
unable to respire L-Asparagine |
||||
|
envC61 |
|||||||
|
ΔenvC725::kan |
|||||||
|
ΔenvC |
deletion |
deletion |
Cell Shape |
Defect in Cell Separation |
|||
|
ΔenvC ΔnlpD |
deletion |
deletion |
Cell Shape |
Defect in Cell Separation |
|||
|
ΔenvC ΔyebA |
deletion |
deletion |
Cell Shape |
Defect in Cell Separation |
|||
|
ΔenvC ΔygeR |
deletion |
deletion |
Cell Shape |
Defect in Cell Separation |
|||
|
ΔenvC ΔnlpD ΔyebA |
deletion |
deletion |
Cell Shape |
Defect in Cell Separation |
|||
|
ΔenvC ΔnlpD ΔygeR |
deletion |
deletion |
Cell Shape |
Defect in Cell Separation |
|||
|
ΔenvC ΔyebA ΔygeR |
deletion |
deletion |
Cell Shape |
Defect in Cell Separation |
|||
|
ΔenvC ΔyebA ΔygeR ΔnlpD |
deletion |
deletion |
Cell Shape |
Defect in Cell Separation |
|||
|
envC |
deletion |
Sensitivity to |
increases sensitivity to bicyclomycin |
fig 2 | |||
| edit table |
<protect></protect>
Notes
In envC mutants, constriction of the OM lags behind the IM and the FtsZ ring.
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW5646 |
Plasmid clone |
Status:Clone OK Primer 1:GCCACACGtGCCGTGAAACCGCG Primer 2:CCTCTTCCCAACCACGGCTGTGG | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
zhg-50::Tn10 |
Linked marker |
est. P1 cotransduction: % [11] | |
|
zic-4901::Tn10 |
Linked marker |
est. P1 cotransduction: 16% [11] | |
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
- ↑ 5.0 5.1 Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed
- ↑ 6.0 6.1 Ito, M et al. (2005) Functional analysis of 1440 Escherichia coli genes using the combination of knock-out library and phenotype microarrays. Metab. Eng. 7 318-27 PubMed
- ↑ 7.0 7.1 7.2 7.3 7.4 7.5 7.6 7.7 Uehara, T et al. (2009) LytM-domain factors are required for daughter cell separation and rapid ampicillin-induced lysis in Escherichia coli. J. Bacteriol. 191 5094-107 PubMed
- ↑ Tran, L et al. (2011) Single-gene deletion mutants of Escherichia coli with altered sensitivity to bicyclomycin, an inhibitor of transcription termination factor Rho. J. Bacteriol. 193 2229-35 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 10.0 10.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 11.0 11.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
