entA:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
entA |
|---|---|
| Mnemonic |
Enterochelin |
| Synonyms |
ECK0589, b0596, JW0588[1], JW0588 |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
13.53 minutes |
MG1655: 627774..628520 |
||
|
NC_012967: 611259..612005 |
||||
|
NC_012759: 530534..531280 |
||||
|
W3110 |
|
W3110: 627774..628520 |
||
|
DH10B: 567106..567852 |
||||
|
DH10B: 680366..681112 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
627774 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔentA (Keio:JW0588) |
deletion |
deletion |
|||||
|
entA::Tn5KAN-2 (FB20211) |
Insertion at nt 281 in Minus orientation |
does not contain pKD46 | |||||
|
entA403 |
|||||||
|
ΔentA |
deletion |
deletion |
Auxotrophies |
Deletion causes uptake of iron via an essential component of Enterobactin (also known as Enterochelin) iron transport system to decrease-Table 3. |
|||
|
ΔentA |
deletion |
deletion |
Auxotrophies |
Deletion reduces the concentration of cytochrome b1 decreasing iron uptake - Table 2 |
| ||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0588 |
Plasmid clone |
Status:Clone OK Primer 1:GCCGATTTCAGCGGTAAAAATGT Primer 2:CCTGCCCCCAGCGTTGAGCCGCC | |
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 1% [10] | ||
|
Linked marker |
est. P1 cotransduction: 77% [10] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Liu, J et al. (1989) Nucleotide sequence of a cluster of Escherichia coli enterobactin biosynthesis genes: identification of entA and purification of its product 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase. J. Bacteriol. 171 791-8 PubMed
- ↑ Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed
- ↑ Ozenberger, BA et al. (1989) Nucleotide sequence of Escherichia coli isochorismate synthetase gene entC and evolutionary relationship of isochorismate synthetase and other chorismate-utilizing enzymes. J. Bacteriol. 171 775-83 PubMed
- ↑ 6.0 6.1 Cox, GB et al. (1970) Mutations affecting iron transport in Escherichia coli. J. Bacteriol. 104 219-26 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 9.0 9.1 CGSC: The Coli Genetics Stock Center
- ↑ 10.0 10.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
