dnaK:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
dnaK |
|---|---|
| Mnemonic |
DNA |
| Synonyms |
ECK0014, b0014, JW0013, grpF, seg, lop, groPAB, groPC, groPF, grpC, dnaL, groP, groPA[1][2] |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
0.26 minutes |
MG1655: 12163..14079 |
||
|
NC_012967: 12161..14077 |
||||
|
NC_012759: 12163..14079 |
||||
|
W3110 |
|
W3110: 12163..14079 |
||
|
DH10B: 12163..14079 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
12166 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
dnaK(del) (Keio:JW0013) |
deletion |
deletion |
|||||
|
dnaKG32D |
G32D |
In SEG-1 and dnaK756(TS); confers temperature sensitivity |
seeded from UniProt:P0A6Y8 | ||||
|
dnaKV436I |
V436I |
In mutant SEG-2; confers temperature sensitivity |
seeded from UniProt:P0A6Y8 | ||||
|
dnaKG455D |
G455D |
In mutant dnaK756(TS); confers temperature sensitivity |
seeded from UniProt:P0A6Y8 | ||||
|
dnaKG468D |
G468D |
In mutant dnaK756(TS); confers temperature sensitivity |
seeded from UniProt:P0A6Y8 | ||||
|
dnaK756(ts) |
temperature sensitive |
||||||
|
dnaK(del)734::kan |
deletion |
deletion |
|||||
|
dnaK |
deletion |
Sensitivity to |
increases sensitivity to bicyclomycin |
fig 2 | |||
|
DnaKG384A |
Glycine to Alanine at position 384. |
There is a 13 fold decrease rate for substrate release in ATP bound state and increase in substrate affinity. with an overall 2.5 fold higher chaperon activity, Table 1. |
|||||
|
G384A/Cd35 |
Double mutant |
The double mutant combines accelerated peptide binding in its ADP-bound state (like Cd35) and slower peptide release in its ATP-bound state (likeG384A), but without additivity in DnaK-assisted firefly luciferase refolding, table 1. |
|||||
|
Cd35 |
35-residue C-terminal truncation |
Cd35 showed a 7-fold increase in initial refolding rate for denatured luciferase and resulted in a 5-fold increase in maximal luminescence as compared to wild type DnaK, Table 3. |
|||||
|
dnaK7 |
revertant |
Mutant is Leu-. When Leu-auxotrophs of Escherichia coli after UV irradiation, were grown at temperatures between 30 and 47C the frequent of UV-induced mutation from Leu- to Leu+ increased as UV dose and temperature increased. Figure 2. |
| ||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0013 |
Plasmid clone |
Status:Clone OK Primer 1:GCCGGTAAAATAATTGGTATCGA Primer 2:CCTTTTTTGTCTTTGACTTCTTC | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 66% [14] | ||
|
Linked marker |
est. P1 cotransduction: 48% [14] | ||
| edit table |
<protect></protect>
Notes
Sugimoto et al [15] constructed a strain carrying a dnaK deletion and the lambda DE3 prophage, which expresses T7 RNA polymerase under lac control.
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ Schmid, D et al. (1992) Precursor of mitochondrial aspartate aminotransferase synthesized in Escherichia coli is complexed with heat-shock protein DnaK. Eur. J. Biochem. 208 699-704 PubMed
- ↑ Freestone, P et al. (1995) Identification of phosphoproteins in Escherichia coli. Mol. Microbiol. 15 573-80 PubMed
- ↑ Link, AJ et al. (1997) Comparing the predicted and observed properties of proteins encoded in the genome of Escherichia coli K-12. Electrophoresis 18 1259-313 PubMed
- ↑ 6.0 6.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 7.0 7.1 7.2 CGSC: The Coli Genetics Stock Center
- ↑ Tran, L et al. (2011) Single-gene deletion mutants of Escherichia coli with altered sensitivity to bicyclomycin, an inhibitor of transcription termination factor Rho. J. Bacteriol. 193 2229-35 PubMed
- ↑ 9.0 9.1 Schweizer, RS et al. (2011) Fine tuning of a biological machine: DnaK gains improved chaperone activity by altered allosteric communication and substrate binding. Chembiochem 12 1559-73 PubMed
- ↑ Aponte, RA et al. (2010) Directed evolution of the DnaK chaperone: mutations in the lid domain result in enhanced chaperone activity. J. Mol. Biol. 399 154-67 PubMed
- ↑ Saha, S & Basu, T (2012) Increase in UV mutagenesis by heat stress on UV-irradiated E. coli cells. Biochem. Genet. 50 484-93 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 13.0 13.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 14.0 14.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ Sugimoto, S et al. (2008) Construction of Escherichia coli dnaK-deletion mutant infected by lambdaDE3 for overexpression and purification of recombinant GrpE proteins. Protein Expr. Purif. 60 31-6 PubMed
