dnaJ:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Standard Name |
dnaJ |
---|---|
Gene Synonym(s) |
ECK0015, b0015, JW0014, groP, grpC[1], faa, grpC |
Product Desc. |
chaperone with DnaK; heat shock protein[2][3]; Component of DnaJ/DnaK/GrpE[2][3] DnaK co-chaperone; stress-related DNA biosynthesis, responsive to heat shock; binds Zn(II)[4] |
Product Synonyms(s) |
chaperone Hsp40, co-chaperone with DnaK[1], B0015[2][1], GrpC[2][1], GroP[2][1], DnaJ[2][1] , ECK0015, faa, groP, grpC, JW0014, b0015 |
Function from GO |
<GO_nr /> |
Knock-Out Phenotype | |
Regulation/Expression | |
Regulation/Activity | |
Quick Links | |
edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
DnaK and DnaJ both bind to the same target peptide, forming a ternary complex.[4]
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Standard name |
dnaJ |
---|---|
Mnemonic |
DNA |
Synonyms |
ECK0015, b0015, JW0014, groP, grpC[1], faa, grpC |
edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
---|---|---|---|---|
MG1655 |
0.31 minutes |
MG1655: 14168..15298 |
||
NC_012967: 14166..15296 |
||||
NC_012759: 14168..15298 |
||||
W3110 |
|
W3110: 14168..15298 |
||
DH10B: 14168..15298 |
||||
edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
---|---|---|---|---|---|
Coding Start (SO:0000323) |
14171 |
Edman degradation |
PMID:3003084 |
| |
edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
---|---|---|---|---|---|---|---|
dnaJC144S |
C144S |
Loss of dnaK-independent chaperone activity; when associated with S-147; S- 197 and S-200 |
seeded from UniProt:P08622 | ||||
dnaJC161H |
C161H |
No effect on chaperone function; when associated with H-183 |
seeded from UniProt:P08622 | ||||
dnaJC147S |
C147S |
Loss of dnaK-independent chaperone activity; when associated with S-144; S- 197 and S-200 |
seeded from UniProt:P08622 | ||||
dnaJKE51AA |
KE51AA |
No effect |
seeded from UniProt:P08622 | ||||
dnaJY54A |
Y54A |
No effect |
seeded from UniProt:P08622 | ||||
dnaJE55A |
E55A |
No effect |
seeded from UniProt:P08622 | ||||
dnaJTD58AA |
TD58AA |
No effect |
seeded from UniProt:P08622 | ||||
dnaJDQ67AA |
DQ67AA |
No effect |
seeded from UniProt:P08622 | ||||
dnaJSQ60AA |
SQ60AA |
No effect |
seeded from UniProt:P08622 | ||||
dnaJKR62AA |
KR62AA |
No effect |
seeded from UniProt:P08622 | ||||
dnaJKE48AA |
KE48AA |
No effect |
seeded from UniProt:P08622 | ||||
dnaJKE41AA |
KE41AA |
No effect |
seeded from UniProt:P08622 | ||||
dnaJE44A |
E44A |
No effect |
seeded from UniProt:P08622 | ||||
dnaJK46A |
K46A |
No effect |
seeded from UniProt:P08622 | ||||
dnaJF47A |
F47A |
Loss of function |
seeded from UniProt:P08622 | ||||
dnaJMK30AA |
MK30AA |
No effect |
seeded from UniProt:P08622 | ||||
dnaJY32A |
Y32A |
No effect |
seeded from UniProt:P08622 | ||||
dnaJH33Q |
H33Q |
Loss of ability to stimulate dnaK ATPase activity |
seeded from UniProt:P08622 | ||||
dnaJQ38A |
Q38A |
No effect |
seeded from UniProt:P08622 | ||||
dnaJP34F |
P34F |
Loss of function |
seeded from UniProt:P08622 | ||||
dnaJD35N |
D35N |
Loss of ability to bind dnaK |
seeded from UniProt:P08622 | ||||
dnaJR36A |
R36A |
Decrease in chaperone function |
seeded from UniProt:P08622 | ||||
dnaJN37A |
N37A |
Decrease in chaperone function |
seeded from UniProt:P08622 | ||||
dnaJL28A |
L28A |
No effect |
seeded from UniProt:P08622 | ||||
dnaJRE19AA |
RE19AA |
No effect |
seeded from UniProt:P08622 | ||||
dnaJY25A |
Y25A |
Loss of activity |
seeded from UniProt:P08622 | ||||
dnaJK26A |
K26A |
Loss of activity |
seeded from UniProt:P08622 | ||||
dnaJA29G |
A29G |
No effect |
seeded from UniProt:P08622 | ||||
dnaJR27A |
R27A |
No effect |
seeded from UniProt:P08622 | ||||
dnaJ(del) (Keio:JW0014) |
deletion |
deletion |
PMID:16738554 |
||||
dnaJC161S |
C161S |
Loss of function; when associated with S-164; S-183 and S-186 |
seeded from UniProt:P08622 | ||||
dnaJC164H |
C164H |
No effect on chaperone function; when associated with H-183 |
seeded from UniProt:P08622 | ||||
dnaJC164S |
C164S |
Loss of function; when associated with S-161; S-183 and S-186 |
seeded from UniProt:P08622 | ||||
dnaJC186H |
C186H |
No effect on chaperone function |
seeded from UniProt:P08622 | ||||
dnaJC186S |
C186S |
Loss of function; when associated with S-161; S-164 and S-184 |
seeded from UniProt:P08622 | ||||
dnaJC197S |
C197S |
Loss of dnaK-independent chaperone activity; when associated with S-144; S- 147 and S-200 |
seeded from UniProt:P08622 | ||||
dnaJC183H |
C183H |
No effect on chaperone function. Same effect; when associated with H-161 or H-164 |
seeded from UniProt:P08622 | ||||
dnaJC183S |
C183S |
Loss of function; when associated with S-161; S-164 and S-186 |
seeded from UniProt:P08622 | ||||
dnaJC200S |
C200S |
Loss of dnaK-independent chaperone activity; when associated with S-144; S- 147 and S-197 |
seeded from UniProt:P08622 | ||||
dnaJ259(ts) |
temperature sensitive |
||||||
dnaJ735(del)::kan |
PMID:16738554 |
||||||
dnaJ(del) |
|
PMID:2144273 |
|||||
Strain BW2952 |
T5C |
A2V |
Nonsynonomous mutation |
PMID:19376874 |
This is a difference relative to E. coli K-12 MG1655. | ||
edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
---|---|---|---|---|---|---|
edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
Resource | Resource Type | Source | Notes/Reference |
---|---|---|---|
JW0014 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCGCTAAGCAAGATTATTACGA Primer 2:CCGCGGGTCAGGTCGTCAAAAAA | |
Kohara Phage |
PMID:3038334 | ||
Kohara Phage |
PMID:3038334 | ||
Linked marker |
est. P1 cotransduction: 61% [6] | ||
Linked marker |
est. P1 cotransduction: 52% [6] | ||
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG10240 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10240 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120000234 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EchoBASE:EB0236 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0000054 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
Standard name |
DnaJ |
---|---|
Synonyms |
chaperone Hsp40, co-chaperone with DnaK[1], B0015[2][1], GrpC[2][1], GroP[2][1], DnaJ[2][1] , ECK0015, faa, groP, grpC, JW0014, b0015 |
Product description |
chaperone with DnaK; heat shock protein[2][3]; Component of DnaJ/DnaK/GrpE[2][3] DnaK co-chaperone; stress-related DNA biosynthesis, responsive to heat shock; binds Zn(II)[4] |
EC number (for enzymes) |
|
edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
---|---|---|---|---|---|---|---|---|
GO:0003756 |
protein disulfide isomerase activity |
PMID:7559385 |
IDA: Inferred from Direct Assay |
F |
Figure 4A- |
complete | ||
GO:0005515 |
protein binding |
PMID:9860950 |
IMP: Inferred from Mutant Phenotype |
F |
complete | |||
GO:0008270 |
zinc ion binding |
PMID:12941935 |
IMP: Inferred from Mutant Phenotype |
F |
complete | |||
GO:0006457 |
protein folding |
PMID:7559385 |
IDA: Inferred from Direct Assay |
P |
complete | |||
GO:0003756 |
protein disulfide isomerase activity |
PMID:7559385 |
IDA: Inferred from Direct Assay |
F |
Seeded from EcoCyc (v14.0) |
complete | ||
GO:0042026 |
protein refolding |
PMID:7559385 |
IDA: Inferred from Direct Assay |
P |
complete | |||
GO:0005515 |
protein binding |
PMID:10521435 |
IPI: Inferred from Physical Interaction |
UniProtKB:P0A6Y8 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0051082 |
unfolded protein binding |
PMID:7559385 |
IDA: Inferred from Direct Assay |
F |
complete | |||
GO:0005524 |
ATP binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR012724 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0042803 |
protein homodimerization activity |
PMID:15849180 |
IDA: Inferred from Direct Assay |
F |
complete | |||
GO:0005737 |
cytoplasm |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_01152 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005624 |
membrane fraction |
PMID:6220698 |
IDA: Inferred from Direct Assay |
C |
complete | |||
GO:0005737 |
cytoplasm |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0963 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005737 |
cytoplasm |
PMID:6220698 |
IDA: Inferred from Direct Assay |
C |
DnaJ can be detected in the soluble fraction as well as being loosely membrane-associated. |
complete | ||
GO:0005737 |
cytoplasm |
GO_REF:0000023 |
IEA: Inferred from Electronic Annotation |
SP_SL:SL-0086 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0008270 |
zinc ion binding |
PMID:11985624 |
IDA: Inferred from Direct Assay |
F |
complete | |||
GO:0005737 |
cytoplasm |
PMID:6220698 |
IDA: Inferred from Direct Assay |
C |
Seeded from EcoCyc (v14.0) |
complete | ||
GO:0005624 |
membrane fraction |
PMID:3889001 |
IDA: Inferred from Direct Assay |
C |
complete | |||
GO:0006260 |
DNA replication |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0235 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0008270 |
zinc ion binding |
PMID:8662861 |
IDA: Inferred from Direct Assay |
F |
complete | |||
GO:0006260 |
DNA replication |
PMID:2144273 |
IMP: Inferred from Mutant Phenotype |
P |
Seeded from EcoCyc (v14.0) |
complete | ||
GO:0006260 |
DNA replication |
PMID:2144273 |
IMP: Inferred from Mutant Phenotype |
P |
λ DNA replication affected |
complete | ||
GO:0006457 |
protein folding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR001305 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0009408 |
response to heat |
PMID:8349564 |
IEP: Inferred from Expression Pattern |
P |
complete | |||
GO:0006457 |
protein folding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR002939 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006457 |
protein folding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR003095 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006457 |
protein folding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR008971 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006457 |
protein folding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR012724 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006950 |
response to stress |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0346 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0008270 |
zinc ion binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0862 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0009408 |
response to heat |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR012724 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0031072 |
heat shock protein binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR001305 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0031072 |
heat shock protein binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR001623 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0031072 |
heat shock protein binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR003095 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0031072 |
heat shock protein binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR018253 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0051082 |
unfolded protein binding |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_01152 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0051082 |
unfolded protein binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR001305 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0051082 |
unfolded protein binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR002939 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0051082 |
unfolded protein binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR003095 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0051082 |
unfolded protein binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR008971 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0051082 |
unfolded protein binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR012724 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
Partner Type | Partner | Notes | References | Evidence |
---|---|---|---|---|
Protein |
Subunits of DnaJ/DnaK/GrpE |
could be indirect |
||
Protein |
mnmG |
PMID:16606699 |
Experiment(s):EBI-1135319 | |
Protein |
sucB |
PMID:16606699 |
Experiment(s):EBI-1135319 | |
Protein |
pdxB |
PMID:16606699 |
Experiment(s):EBI-1135319 | |
Protein |
aceE |
PMID:15690043 |
Experiment(s):EBI-883621 | |
Protein |
add |
PMID:15690043 |
Experiment(s):EBI-883621 | |
Protein |
atpD |
PMID:15690043 |
Experiment(s):EBI-883621 | |
Protein |
clpA |
PMID:15690043 |
Experiment(s):EBI-883621 | |
Protein |
deaD |
PMID:15690043 |
Experiment(s):EBI-883621, EBI-881486 | |
Protein |
dnaK |
PMID:15690043 |
Experiment(s):EBI-883621 | |
Protein |
gatY |
PMID:15690043 |
Experiment(s):EBI-883621 | |
Protein |
imp |
PMID:15690043 |
Experiment(s):EBI-883621 | |
Protein |
infB |
PMID:15690043 |
Experiment(s):EBI-883621 | |
Protein |
malT |
PMID:15690043 |
Experiment(s):EBI-883621, EBI-879887 | |
Protein |
metK |
PMID:15690043 |
Experiment(s):EBI-883621, EBI-881611, EBI-889076 | |
Protein |
mreB |
PMID:15690043 |
Experiment(s):EBI-883621, EBI-888239, EBI-893751 | |
Protein |
mukB |
PMID:15690043 |
Experiment(s):EBI-883621 | |
Protein |
narG |
PMID:15690043 |
Experiment(s):EBI-883621, EBI-880367 | |
Protein |
pstB |
PMID:15690043 |
Experiment(s):EBI-883621, EBI-891381 | |
Protein |
recA |
PMID:15690043 |
Experiment(s):EBI-883621 | |
Protein |
relE |
PMID:15690043 |
Experiment(s):EBI-883621 | |
Protein |
rho |
PMID:15690043 |
Experiment(s):EBI-883621 | |
Protein |
rplA |
PMID:15690043 |
Experiment(s):EBI-883621 | |
Protein |
rplJ |
PMID:15690043 |
Experiment(s):EBI-883621 | |
Protein |
rplS |
PMID:15690043 |
Experiment(s):EBI-883621 | |
Protein |
rplV |
PMID:15690043 |
Experiment(s):EBI-883621 | |
Protein |
rpoC |
PMID:15690043 |
Experiment(s):EBI-883621 | |
Protein |
rpsB |
PMID:15690043 |
Experiment(s):EBI-883621 | |
Protein |
rpsE |
PMID:15690043 |
Experiment(s):EBI-883621 | |
Protein |
rpsJ |
PMID:15690043 |
Experiment(s):EBI-883621, EBI-890903 | |
Protein |
rpsM |
PMID:15690043 |
Experiment(s):EBI-883621 | |
Protein |
srmB |
PMID:15690043 |
Experiment(s):EBI-883621, EBI-889906 | |
Protein |
trxC |
PMID:15690043 |
Experiment(s):EBI-883621 | |
Protein |
tufA |
PMID:15690043 |
Experiment(s):EBI-883621, EBI-894882 | |
Protein |
yjbJ |
PMID:15690043 |
Experiment(s):EBI-883621 | |
Protein |
rplX |
PMID:15690043 |
Experiment(s):EBI-890903 | |
Protein |
rpsF |
PMID:15690043 |
Experiment(s):EBI-890903 | |
Protein |
rpsN |
PMID:15690043 |
Experiment(s):EBI-890903 | |
Protein |
rplW |
PMID:15690043 |
Experiment(s):EBI-890903 | |
Protein |
rpsN |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
atpD |
PMID:19402753 |
MALDI(Z-score):21.544534 | |
Protein |
rpsJ |
PMID:19402753 |
LCMS(ID Probability):99.2 MALDI(Z-score):17.053160 | |
Protein |
rpsF |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
rplX |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
Protein |
clpA |
PMID:19402753 |
MALDI(Z-score):25.335090 | |
Protein |
rplW |
PMID:19402753 |
LCMS(ID Probability):99.2 | |
Protein |
infB |
PMID:19402753 |
MALDI(Z-score):28.138730 | |
Protein |
rpsC |
PMID:19402753 |
MALDI(Z-score):21.413861 | |
Protein |
fusA |
PMID:19402753 |
MALDI(Z-score):27.235301 | |
Protein |
rho |
PMID:19402753 |
MALDI(Z-score):20.842792 | |
Protein |
recA |
PMID:19402753 |
MALDI(Z-score):22.079568 | |
Protein |
gatY |
PMID:19402753 |
MALDI(Z-score):22.028812 | |
Protein |
ompC |
PMID:19402753 |
MALDI(Z-score):18.221442 | |
edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
Compartment | Description | Evidence | Reference/Source | Notes |
---|---|---|---|---|
edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
Name | |
---|---|
Sequence |
MAKQDYYEIL GVSKTAEERE IRKAYKRLAM KYHPDRNQGD KEAEAKFKEI KEAYEVLTDS QKRAAYDQYG HAAFEQGGMG GGGFGGGADF SDIFGDVFGD IFGGGRGRQR AARGADLRYN MELTLEEAVR GVTKEIRIPT LEECDVCHGS GAKPGTQPQT CPTCHGSGQV QMRQGFFAVQ QTCPHCQGRG TLIKDPCNKC HGHGRVERSK TLSVKIPAGV DTGDRIRLAG EGEAGEHGAP AGDLYVQVQV KQHPIFEREG NNLYCEVPIN FAMAALGGEI EVPTLDGRVK LKVPGETQTG KLFRMRGKGV KSVRGGAQGD LLCRVVVETP VGLNERQKQL LQELQESFGG PTGEHNSPRS KSFFDGVKKF FDDLTR |
Length |
376 |
Mol. Wt |
41.099 kDa |
pI |
8.0 (calculated) |
Extinction coefficient |
14,900 - 16,150 (calc based on 10 Y, 0 W, and 10 C residues) |
edit table |
Domains/Motifs/Modification Sites
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
Resource type | Source | Notes/Reference |
---|---|---|
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
Escherichia coli str. K-12 substr. MG1655 | ||
ASAP:ABE-0000054 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EcoCyc:EG10240 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10240 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
RegulonDB:ECK120000234 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EchoBASE:EB0236 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
---|---|---|---|---|---|---|---|
Protein |
E. coli K-12 MC4100 |
8.05E+02 |
molecules/cell |
|
emPAI |
PMID:18304323 | |
Protein |
Ecoli K-12 |
68.948+/-0.33 |
Molecules/cell |
|
Single Molecule Fluorescence |
PMID:20671182 | |
mRNA |
Ecoli K-12 |
0.12699115 |
Molecules/cell |
|
by RNA_Seq |
PMID:20671182 | |
Protein |
E. coli K-12 MG1655 |
5688 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
938 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
Protein |
E. coli K-12 MG1655 |
4951 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:14148..14188
source=MG1655
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
Allele Name | Mutation | Phenotype | Reference |
---|---|---|---|
edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
Type | Reference | Notes |
---|---|---|
microarray |
NCBI GEO profiles for dnaJ | |
microarray |
Summary of data for dnaJ from multiple microarray studies | |
edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
Resource Name | Resource Type | Description | Source | Notes |
---|---|---|---|---|
edit table |
<protect></protect>
Notes
Accessions Related to dnaJ Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG10240 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB0236 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10240 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120000234 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0000054 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
Organism | Homologs (Statistics) | Comments |
---|---|---|
Anopheles gambiae |
|
From Inparanoid:20070104 |
Apis mellifera |
|
From Inparanoid:20070104 |
Arabidopsis thaliana |
|
From Inparanoid:20070104 |
Bos taurus |
|
From Inparanoid:20070104 |
Caenorhabditis briggsae |
|
From Inparanoid:20070104 |
Caenorhabditis elegans |
|
From Inparanoid:20070104 |
Canis familiaris |
|
From Inparanoid:20070104 |
Ciona intestinalis |
|
From Inparanoid:20070104 |
Danio rerio |
|
From Inparanoid:20070104 |
Dictyostelium discoideum |
|
From Inparanoid:20070104 |
Drosophila melanogaster |
|
From Inparanoid:20070104 |
Drosophila pseudoobscura |
|
From Inparanoid:20070104 |
Gallus gallus |
|
From Inparanoid:20070104 |
Homo sapiens |
|
From Inparanoid:20070104 |
Macaca mulatta |
|
From Inparanoid:20070104 |
Monodelphis domestica |
|
From Inparanoid:20070104 |
Mus musculus |
|
From Inparanoid:20070104 |
Oryza gramene |
|
From Inparanoid:20070104 |
Pan troglodytes |
|
From Inparanoid:20070104 |
Rattus norvegicus |
|
From Inparanoid:20070104 |
Saccharomyces cerevisiae |
|
From Inparanoid:20070104 |
Schizosaccharomyces pombe |
|
From Inparanoid:20070104 |
Takifugu rubripes |
|
From Inparanoid:20070104 |
Tetraodon nigroviridis |
|
From Inparanoid:20070104 |
Xenopus tropicalis |
|
From Inparanoid:20070104 |
Shigella flexneri |
DNAJ |
From SHIGELLACYC |
E. coli O157 |
DNAJ |
From ECOO157CYC |
edit table |
Do-It-Yourself Web Tools
<protect></protect>
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG10240 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG10240 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120000234 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB0236 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0000054 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 2.11 2.12 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 3.2 3.3 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
Categories
- Genes with homologs in Anopheles gambiae
- Genes with homologs in Apis mellifera
- Genes with homologs in Arabidopsis thaliana
- Genes with homologs in Bos taurus
- Genes with homologs in Caenorhabditis briggsae
- Genes with homologs in Caenorhabditis elegans
- Genes with homologs in Canis familiaris
- Genes with homologs in Ciona intestinalis
- Genes with homologs in Danio rerio
- Genes with homologs in Dictyostelium discoideum
- Genes with homologs in Drosophila melanogaster
- Genes with homologs in Drosophila pseudoobscura
- Genes with homologs in Gallus gallus
- Genes with homologs in Homo sapiens
- Genes with homologs in Macaca mulatta
- Genes with homologs in Monodelphis domestica
- Genes with homologs in Mus musculus
- Genes with homologs in Oryza gramene
- Genes with homologs in Pan troglodytes
- Genes with homologs in Rattus norvegicus
- Genes with homologs in Saccharomyces cerevisiae
- Genes with homologs in Schizosaccharomyces pombe
- Genes with homologs in Takifugu rubripes
- Genes with homologs in Tetraodon nigroviridis
- Genes with homologs in Xenopus tropicalis
- Genes with homologs in Shigella flexneri
- Genes with homologs in E. coli O157