dfp:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
dfp |
|---|---|
| Mnemonic |
DNA synthesis FlavoProtein |
| Synonyms |
ECK3629, b3639, JW5642, dnaS, coaBC[1], coaBC |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
82.13 minutes, 82.13 minutes |
MG1655: 3810754..3811974 |
||
|
NC_012967: 3751086..3752306 |
||||
|
NC_012759: 3699080..3700300 |
||||
|
W3110 |
|
W3110: 3827684..3826464 |
||
|
DH10B: 3908331..3909551 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
3810757 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
coaBCP89A |
P89A |
Binds FMN, but more loosely than wild-type |
seeded from UniProt:P0ABQ0 | ||||
|
coaBCP89D |
P89D |
No FMN binding |
seeded from UniProt:P0ABQ0 | ||||
|
coaBCT91V |
T91V |
Binds FMN |
seeded from UniProt:P0ABQ0 | ||||
|
coaBCN125D,Q |
N125D,Q |
Loss of activity |
seeded from UniProt:P0ABQ0 | ||||
|
coaBCM128L |
M128L |
Severely reduced activity |
seeded from UniProt:P0ABQ0 | ||||
|
coaBCD203N |
D203N |
Loss of dimerization |
seeded from UniProt:P0ABQ0 | ||||
|
coaBCN210D |
N210D |
Loss of activity, reaction intermediate detectable |
seeded from UniProt:P0ABQ0 | ||||
|
coaBCG14S |
G14S |
No FMN binding |
seeded from UniProt:P0ABQ0 | ||||
|
coaBCG15A |
G15A |
Less than 5% of wild-type activity |
seeded from UniProt:P0ABQ0 | ||||
|
coaBCI16L |
I16L |
Severely reduced activity |
seeded from UniProt:P0ABQ0 | ||||
|
coaBCK289Q |
K289Q |
Loss of activity |
seeded from UniProt:P0ABQ0 | ||||
|
coaBCK291Q |
K291Q |
Reduced activity |
seeded from UniProt:P0ABQ0 | ||||
|
coaBCK292Q |
K292Q |
Small effect on activity |
seeded from UniProt:P0ABQ0 | ||||
|
coaBCK215Q |
K215Q |
No effect |
seeded from UniProt:P0ABQ0 | ||||
|
coaBCA275V |
A275V |
Loss of dimerization |
seeded from UniProt:P0ABQ0 | ||||
|
coaBCN210H,K |
N210H,K |
Loss of activity, reaction intermediate not detectable |
seeded from UniProt:P0ABQ0 | ||||
|
coaBCS212A |
S212A |
Small effect on activity |
seeded from UniProt:P0ABQ0 | ||||
|
coaBCC158A,S |
C158A,S |
Loss of activity |
seeded from UniProt:P0ABQ0 | ||||
|
coaBCT194V |
T194V |
Loss of dimerization |
seeded from UniProt:P0ABQ0 | ||||
|
coaBCT198V |
T198V |
Loss of dimerization |
seeded from UniProt:P0ABQ0 | ||||
|
coaBCM124L |
M124L |
No effect |
seeded from UniProt:P0ABQ0 | ||||
|
coaBCA17G,S |
A17G,S |
Almost wild-type activity |
seeded from UniProt:P0ABQ0 | ||||
|
coaBCY19F |
Y19F |
Almost wild-type activity |
seeded from UniProt:P0ABQ0 | ||||
|
coaBCY19L |
Y19L |
Reduced activity |
seeded from UniProt:P0ABQ0 | ||||
|
coaBCK20N,Q |
K20N,Q |
Reduced activity |
seeded from UniProt:P0ABQ0 | ||||
|
coaBCK20R |
K20R |
Almost wild-type activity |
seeded from UniProt:P0ABQ0 | ||||
|
coaBCF46L |
F46L |
Reduced activity |
seeded from UniProt:P0ABQ0 | ||||
|
coaBCH75N |
H75N |
Loss of activity |
seeded from UniProt:P0ABQ0 | ||||
|
coaBCA17D |
A17D |
Less than 5% of wild-type activity |
seeded from UniProt:P0ABQ0 | ||||
|
coaBCG11D |
G11D |
In Dfp-707; temperature-sensitive, impairs folding |
seeded from UniProt:P0ABQ0 | ||||
|
coaBCI16V |
I16V |
Slightly reduced activity |
seeded from UniProt:P0ABQ0 | ||||
|
dfp::Tn5KAN-I-SceI (FB21356) |
Insertion at nt 1182 in Minus orientation |
contains pKD46 | |||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW5642 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAGCCTtGCCGGTAAAAAAAT Primer 2:CCACGTCGATTTTTTTCATCATA | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
zhg-50::Tn10 |
Linked marker |
est. P1 cotransduction: % [7] | |
|
zic-4901::Tn10 |
Linked marker |
est. P1 cotransduction: 55% [7] | |
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Kupke, T et al. (2000) Molecular characterization of lantibiotic-synthesizing enzyme EpiD reveals a function for bacterial Dfp proteins in coenzyme A biosynthesis. J. Biol. Chem. 275 31838-46 PubMed
- ↑ Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 5.0 5.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 6.0 6.1 CGSC: The Coli Genetics Stock Center
- ↑ 7.0 7.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
