cysK:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
cysK |
|---|---|
| Mnemonic |
Cysteine |
| Synonyms | |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
54.54 minutes |
MG1655: 2530431..2531402 |
||
|
NC_012967: 2461135..2462106 |
||||
|
NC_012759: 2416236..2417207 |
||||
|
W3110 |
|
W3110: 2537855..2538826 |
||
|
DH10B: 2622196..2623167 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
2530434 |
Edman degradation |
PMID:8506346[3] |
| |
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔcysK (Keio:JW2407) |
deletion |
deletion |
Auxotrophies |
Requires cysteine for growth |
|||
|
cysK::Tn5KAN-2 (FB20787) |
Insertion at nt 801 in Minus orientation |
Auxotrophies |
Requires cysteine for growth |
contains pKD46 | |||
|
cysK511 |
Auxotrophies |
Requires cysteine for growth |
|||||
|
ΔcysK743::kan |
deletion |
deletion |
Auxotrophies |
Requires cysteine for growth |
|||
|
cysK4 |
Resistant to |
is still prototrophic but has selenite resistance |
allele has same phenotype as 3 other alleles (cysK7, cysK8, and cysK11) | ||||
|
cysK68 |
Auxotrophies |
has significantly lower O-acetlyserine suphydrase activity |
|||||
|
cysK67 |
Growth Phenotype |
grew at a slightly decreased rate in sulphate minimal medium, has decreased O-acetylserine sulphydrase and sulphat permease activities |
|||||
|
cysK71 |
Growth Phenotype |
growth rate is reduced by half, had lowered O-acetylserine sulphydrase and sulphate permease activities |
|||||
|
cysK80 |
Growth Phenotype |
division time is about 3 times longer than wild-type (altering sulfur source shortened generation time), significantly lowered O-acetylerine sulphydrylase and sulphate permease activities but higher sulphite reductase activity |
similar activity found in cysK81 | ||||
|
cysK4 |
Resistant to |
is still prototrophic and is resistant to 3mM-1,2,4-triazole |
allele has same phenotype as 3 other alleles (cysK7, cysK8, and cysK11) | ||||
|
cysK4 |
Altered enzyme activity |
reduced O-acetyl-serine sulphydrylase activity (approx. 5% of parent strain) |
allele has same phenotype as 3 other alleles (cysK7, cysK8, and cysK11); parent strain: K-12 PA309 | ||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW2407 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAGTAAGATTTTTGAAGATAA Primer 2:CCtTGTTGCAATTCTTTCTCAGT | |
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 48% [15] | ||
|
Linked marker |
est. P1 cotransduction: 3% [15] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ Henzel, WJ et al. (1993) Identifying proteins from two-dimensional gels by molecular mass searching of peptide fragments in protein sequence databases. Proc. Natl. Acad. Sci. U.S.A. 90 5011-5 PubMed
- ↑ Flint, DH et al. (1996) Studies on the synthesis of the Fe-S cluster of dihydroxy-acid dehydratase in escherichia coli crude extract. Isolation of O-acetylserine sulfhydrylases A and B and beta-cystathionase based on their ability to mobilize sulfur from cysteine and to participate in Fe-S cluster synthesis. J. Biol. Chem. 271 16053-67 PubMed
- ↑ Pasquali, C et al. (1996) Two-dimensional gel electrophoresis of Escherichia coli homogenates: the Escherichia coli SWISS-2DPAGE database. Electrophoresis 17 547-55 PubMed
- ↑ Quadroni, M et al. (1996) Analysis of global responses by protein and peptide fingerprinting of proteins isolated by two-dimensional gel electrophoresis. Application to the sulfate-starvation response of Escherichia coli. Eur. J. Biochem. 239 773-81 PubMed
- ↑ Link, AJ et al. (1997) Comparing the predicted and observed properties of proteins encoded in the genome of Escherichia coli K-12. Electrophoresis 18 1259-313 PubMed
- ↑ 8.0 8.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 9.0 9.1 9.2 CGSC: The Coli Genetics Stock Center
- ↑ Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed
- ↑ 11.0 11.1 11.2 Fimmel, AL & Loughlin, RE (1977) Isolation and characterization of cysK mutants of Escherichia coli K12. J. Gen. Microbiol. 103 37-43 PubMed
- ↑ 12.0 12.1 12.2 12.3 Wiater, A & Hulanicka, D (1979) Properties of cysK mutants of Escherichia coli K12. Acta Biochim. Pol. 26 21-8 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 15.0 15.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
