cyaY:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
| Standard Name |
cyaY |
|---|---|
| Gene Synonym(s) |
ECK3801, b3807, JW3779[1], JW3779 |
| Product Desc. |
iron-binding frataxin homolog[2][3] Iron donor during [Fe-S] cluster assembly on IscU; iron-binding and oxidizing protein[4] |
| Product Synonyms(s) |
frataxin, iron-binding and oxidizing protein[1], B3807[2][1], CyaY[2][1] , ECK3801, JW3779, b3807 |
| Function from GO |
<GO_nr /> |
| Knock-Out Phenotype | |
| Regulation/Expression | |
| Regulation/Activity | |
| Quick Links | |
| edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
CyaY forms iron-promoted aggregates in vitro, but not at physiological salt concentrations. There is no iron accumulation or oxidative stress defect in cyaY mutant or overproducing strains. cyaY is expressed, as measured using LacZ fusions (Trotot, 1996). Frataxin-related. A dubious 116 codon ORF named cyaX on the opposite strand of cyaY was dropped (Aiba, 1984).[4]
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
cyaY |
|---|---|
| Mnemonic |
Cyclase, adenylate |
| Synonyms |
ECK3801, b3807, JW3779[1], JW3779 |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
86.04 minutes |
MG1655: 3992082..3991762 |
||
|
NC_012967: 3955889..3955569 |
||||
|
NC_012759: 3881431..3881751 |
||||
|
W3110 |
|
W3110: 3642622..3642942 |
||
|
DH10B: 4091002..4090682 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔcyaY (Keio:JW3779) |
deletion |
deletion |
PMID:16738554 |
| |||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW3779 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCAACGACAGTGAATTTCATCG Primer 2:CCGCGGAAACTGACTGTTTCACC | |
|
Kohara Phage |
PMID:3038334 | ||
|
Linked marker |
est. P1 cotransduction: 20% [6] | ||
|
metEo-3079::Tn10 |
Linked marker |
est. P1 cotransduction: 55% [6] | |
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG11653 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG11653 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120001597 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EchoBASE:EB1606 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0012435 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
| Standard name |
CyaY |
|---|---|
| Synonyms |
frataxin, iron-binding and oxidizing protein[1], B3807[2][1], CyaY[2][1] , ECK3801, JW3779, b3807 |
| Product description |
iron-binding frataxin homolog[2][3] Iron donor during [Fe-S] cluster assembly on IscU; iron-binding and oxidizing protein[4] |
| EC number (for enzymes) |
|
| edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
| Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
|---|---|---|---|---|---|---|---|---|
|
GO:0005737 |
cytoplasm |
PMID:17650323 |
IDA: Inferred from Direct Assay |
C |
Fig. 5 and Fig. 6. |
complete | ||
|
GO:0016226 |
iron-sulfur cluster assembly |
PMID:16603772 |
IDA: Inferred from Direct Assay |
P |
In vitro iron donor to IscU in the presence of IscS and cysteine (Fig. 6). |
complete | ||
|
GO:0016226 |
iron-sulfur cluster assembly |
PMID:17727661 |
IGI: Inferred from Genetic Interaction |
UniProtKB:Q07540 |
P |
Complementation of a yeast strain depleted of the endogenous frataxin protein (yfh1Delta). |
complete | |
|
GO:0008199 |
ferric iron binding |
PMID:16603772 |
IDA: Inferred from Direct Assay |
F |
Strong binding of Fe(+3) and weak binding of Fe(+2). |
complete | ||
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
| Partner Type | Partner | Notes | References | Evidence |
|---|---|---|---|---|
|
Protein |
dnaN |
PMID:19402753 |
MALDI(Z-score):24.136689 | |
| edit table |
</protect>
Notes
CyaY is proposed to be an iron chaperone that sequesters free, redox active Fe.[7] In vitro, CyaY can bind iron and prevents the formation of hydroxyl free radicals in the presence of hydrogen peroxide (Fig. 5 of PMID:17244611).
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
| Compartment | Description | Evidence | Reference/Source | Notes |
|---|---|---|---|---|
|
Cytoplasm |
Western blot analysis of soluble and membrane fractions (Fig. 5). Visualization of an overproduced CyaY-Gfp fusion protein (Fig. 6). |
PMID:17650323 |
| |
| edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
| Name | |
|---|---|
| Sequence |
MNDSEFHRLA DQLWLTIEER LDDWDGDSDI DCEINGGVLT ITFENGSKII INRQEPLHQV WLATKQGGYH FDLKGDEWIC DRSGETFWDL LEQAATQQAG ETVSFR |
| Length |
106 |
| Mol. Wt |
12.231 kDa |
| pI |
4.1 (calculated) |
| Extinction coefficient |
28,990 - 29,240 (calc based on 1 Y, 5 W, and 2 C residues) |
| edit table |
Domains/Motifs/Modification Sites
|
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
|
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
| Resource type | Source | Notes/Reference |
|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
ASAP:ABE-0012435 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EcoCyc:EG11653 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG11653 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
RegulonDB:ECK120001597 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB1606 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
| Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
|---|---|---|---|---|---|---|---|
|
Protein |
E. coli K-12 MC4100 |
3.15E+02 |
molecules/cell |
|
emPAI |
PMID:18304323 | |
|
Protein |
Ecoli K-12 |
52.261+/-0.535 |
Molecules/cell |
|
Single Molecule Fluorescence |
PMID:20671182 | |
|
mRNA |
Ecoli K-12 |
0.140625 |
Molecules/cell |
|
by RNA_Seq |
PMID:20671182 | |
|
Protein |
E. coli K-12 MG1655 |
4479 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
963 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
1815 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
| edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
|
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
Figure courtesy of RegulonDB |
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:3992062..3992102
source=MG1655
flip=1
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
| Allele Name | Mutation | Phenotype | Reference |
|---|---|---|---|
| edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
| Type | Reference | Notes |
|---|---|---|
|
microarray |
NCBI GEO profiles for cyaY | |
|
microarray |
Summary of data for cyaY from multiple microarray studies | |
| edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
| Resource Name | Resource Type | Description | Source | Notes |
|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions Related to cyaY Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG11653 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB1606 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG11653 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120001597 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0012435 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
| Organism | Homologs (Statistics) | Comments |
|---|---|---|
|
Oryza gramene |
|
From Inparanoid:20070104 |
|
Schizosaccharomyces pombe |
|
From Inparanoid:20070104 |
|
Shigella flexneri |
CYAY |
From SHIGELLACYC |
|
E. coli O157 |
CYAY |
From ECOO157CYC |
| edit table |
Do-It-Yourself Web Tools
<protect></protect>
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG11653 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG11653 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120001597 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB1606 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0012435 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 2.2 2.3 2.4 2.5 2.6 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 5.0 5.1 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ Ding, H et al. (2007) Distinct iron binding property of two putative iron donors for the iron-sulfur cluster assembly: IscA and the bacterial frataxin ortholog CyaY under physiological and oxidative stress conditions. J. Biol. Chem. 282 7997-8004 PubMed
Categories


