ada:On One Page

From EcoliWiki
Jump to: navigation, search

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Quickview | Gene | Product(s) | Expression| Evolution | References |

Quickview

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

<protect>

Standard Name

ada

Gene Synonym(s)

ECK2205, b2213, JW2201[1], JW2201

Product Desc.

Ada transcriptional dual regulator[2][3]

O6-methylguanine-DNA methyltransferase, transcription factor; inducible; DNA repair against methylating and alkylating agents; binds Zn(II)[4]

Product Synonyms(s)

fused DNA-binding transcriptional dual regulator[1], O6-methylguanine-DNA methyltransferase[1], B2213[2][1], Ada[2][1] , ECK2205, JW2201, b2213

Function from GO

<GO_nr />

Knock-Out Phenotype
Regulation/Expression

transcription unit(s): ada-alkB[2], OP00100

Regulation/Activity
Quick Links

porteco.png EcoCyc.gif regulondb.jpg

dnadisplay.png proteindisplay.png   pubmed.jpg   textpresso.jpg  

</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>

Notes

[back to top]


The Ada N-terminal domain acts as a transcriptional activator of ada, alkA, alkB and aidB. Ogt, Ada-C and YbaZ are homologous.[4]



Gene

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css> <protect>

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

ada

Mnemonic

Adaptive (response)

Synonyms

ECK2205, b2213, JW2201[1], JW2201

</protect>

Notes

Location(s) and DNA Sequence

[back to top]


<protect> See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

49.73 minutes 

MG1655: 2308427..2307363
<gbrowseImage> name=NC_000913:2307363..2308427 source=MG1655 preset=GeneLocation </gbrowseImage>

REL606

NC_012967: 2260509..2259445
<gbrowseImage> name=NC_012967:2259445..2260509 source=REL606 preset=GeneLocation </gbrowseImage>

BW2952

NC_012759: 2193168..2194232
<gbrowseImage> name=NC_012759:2193168..2194232 source=BW2952 preset=GeneLocation </gbrowseImage>

W3110

 

W3110: 2313739..2312675
<gbrowseImage> name=NC_007779:2312675..2313739 source=W3110 preset=GeneLocation </gbrowseImage>

DH10B

DH10B: 2399415..2398351
<gbrowseImage> name=NC_010473:2398351..2399415 source=DH10B preset=GeneLocation </gbrowseImage>

</protect>

Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

2307363

Edman degradation

PMID:2987251


<protect></protect>

Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

adaE75D

E75D

(in strain: B)

Strain variation; seeded from UniProt:P06134

adaAQ79PR

AQ79PR

(in strain: B)

Strain variation; seeded from UniProt:P06134

adaI318V

I318V

(in strain: B)

Strain variation; seeded from UniProt:P06134

adaT330S

T330S

(in strain: B)

Strain variation; seeded from UniProt:P06134

Δada (Keio:JW2201)

deletion

deletion

PMID:16738554

Shigen
CGSC9780[5]

ada::Tn5KAN-2 (FB20708)

Insertion at nt 687 in Minus orientation

PMID:15262929

E. coli Genome Project:FB20708

does not contain pKD46

ada::Tn5KAN-2 (FB20709)

Insertion at nt 687 in Minus orientation

PMID:15262929

E. coli Genome Project:FB20709

contains pKD46

ada-1

CGSC:12943

ada-2

CGSC:12946

ada-3

CGSC:12948

ada-4

CGSC:12950

ada-5

CGSC:12952

ada-6

CGSC:12954

ada-766(del)::kan

PMID:16738554

CGSC:99908


<protect></protect>

Notes

Genetic Interactions

[back to top]


<protect>

Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

</protect>

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW2201

Plasmid clone

Shigen

PMID:16769691

Status:Clone OK

Primer 1:GCCAAAAAAGCCACATGCTTAAC

Primer 2:CCtCTCTCCTCATTTTCAGCTTC

22A6

Kohara Phage

Genobase

PMID:3038334

napA722::Tn10

Linked marker

CAG12098 = CGSC7400[5]

est. P1 cotransduction: 82% [6]
Synonyms:zeg-722, zei-722::Tn10

atoS298::Tn10

Linked marker

CAG12177 gyrA+ = CGSC7525[5]

est. P1 cotransduction: 65% [6]
Synonyms:zeh-298::Tn10, zej-298::Tn10 nnnThe original CAG12177 was NalR. This is a NalS derivative constructed by S. McAteer (CGSC).

<protect></protect>

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10029

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10029

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000026

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:946710

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0028

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0007311

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]



Product(s)

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name

Ada

Synonyms

fused DNA-binding transcriptional dual regulator[1], O6-methylguanine-DNA methyltransferase[1], B2213[2][1], Ada[2][1] , ECK2205, JW2201, b2213

Product description

Ada transcriptional dual regulator[2][3]

O6-methylguanine-DNA methyltransferase, transcription factor; inducible; DNA repair against methylating and alkylating agents; binds Zn(II)[4]

EC number (for enzymes)

<protect></protect>

Notes

Function

[back to top]


<protect> Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier GO ID GO term name Reference Evidence Code with/from Aspect Notes Status

GO:0003677

DNA binding

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR004026

F

Seeded from EcoCyc (v14.0)

complete

GO:0003677

DNA binding

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0238

F

Seeded from EcoCyc (v14.0)

complete

GO:0003700

transcription factor activity

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR000005

F

Seeded from EcoCyc (v14.0)

complete

GO:0003824

catalytic activity

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR014048

F

Seeded from EcoCyc (v14.0)

complete

GO:0003908

methylated-DNA-(protein)-cysteine S-methyltransferase activity

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR001497

F

Seeded from EcoCyc (v14.0)

complete

GO:0003908

methylated-DNA-(protein)-cysteine S-methyltransferase activity

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR008332

F

Seeded from EcoCyc (v14.0)

complete

GO:0003908

methylated-DNA-(protein)-cysteine S-methyltransferase activity

GOA:spec
GO_REF:0000003

IEA: Inferred from Electronic Annotation

EC:2.1.1.63

F

Seeded from EcoCyc (v14.0)

complete

GO:0005622

intracellular

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR000005

C

Seeded from EcoCyc (v14.0)

complete

GO:0006281

DNA repair

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR001497

P

Seeded from EcoCyc (v14.0)

complete

GO:0006281

DNA repair

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR004026

P

Seeded from EcoCyc (v14.0)

complete

GO:0006281

DNA repair

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR008332

P

Seeded from EcoCyc (v14.0)

complete

GO:0006281

DNA repair

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR014048

P

Seeded from EcoCyc (v14.0)

complete

GO:0006281

DNA repair

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0234

P

Seeded from EcoCyc (v14.0)

complete

GO:0006350

transcription

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0804

P

Seeded from EcoCyc (v14.0)

complete

GO:0006355

regulation of transcription, DNA-dependent

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR000005

P

Seeded from EcoCyc (v14.0)

complete

GO:0006355

regulation of transcription, DNA-dependent

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR004026

P

Seeded from EcoCyc (v14.0)

complete

GO:0006974

response to DNA damage stimulus

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0227

P

Seeded from EcoCyc (v14.0)

complete

GO:0008270

zinc ion binding

PMID:1581309

IDA: Inferred from Direct Assay

F

N-terminal domain binds Zn

complete

GO:0008168

methyltransferase activity

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR004026

F

Seeded from EcoCyc (v14.0)

complete

GO:0008168

methyltransferase activity

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0489

F

Seeded from EcoCyc (v14.0)

complete

GO:0008270

zinc ion binding

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR004026

F

Seeded from EcoCyc (v14.0)

complete

GO:0008270

zinc ion binding

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0862

F

Seeded from EcoCyc (v14.0)

complete

GO:0008270

zinc ion binding

PMID:1581309

IDA: Inferred from Direct Assay

F

Seeded from EcoCyc (v14.0)

complete

GO:0016740

transferase activity

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0808

F

Seeded from EcoCyc (v14.0)

complete

GO:0043565

sequence-specific DNA binding

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR000005

F

Seeded from EcoCyc (v14.0)

complete

GO:0003908

methylated-DNA-(protein)-cysteine S-methyltransferase activity

PMID:6754717

IDA: Inferred from Direct Assay

F

complete

GO:0005625

soluble fraction

PMID:6754717

IDA: Inferred from Direct Assay

C

complete

GO:0080111

DNA demethylation

PMID:6754717

IDA: Inferred from Direct Assay

P

complete

GO:0006307

DNA dealkylation involved in DNA repair

PMID:282622

IDA: Inferred from Direct Assay

P

complete

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type Partner Notes References Evidence

Protein

rplB

PMID:16606699

Experiment(s):EBI-1142195

Protein

rpsC

PMID:16606699

Experiment(s):EBI-1142195

Protein

moeB

PMID:16606699

Experiment(s):EBI-1142195

Protein

fur

PMID:16606699

Experiment(s):EBI-1142195

Protein

rpsG

PMID:16606699

Experiment(s):EBI-1142195

Protein

ybiA

PMID:16606699

Experiment(s):EBI-1142195

</protect>

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment Description Evidence Reference/Source Notes

membrane

From EcoCyc[3]


<protect></protect>

Notes

Structure and Physical Properties

[back to top]


<protect> Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence

at EcoCyc

MKKATCLTDD QRWQSVLARD PNADGEFVFA VRTTGIFCRP SCRARHALRE NVSFYANASE
ALAAGFRPCK RCQPEKANAQ QHRLDKITHA CRLLEQETPV TLEALADQVA MSPFHLHRLF
KATTGMTPKA WQQAWRARRL RESLAKGESV TTSILNAGFP DSSSYYRKAD ETLGMTAKQF
RHGGENLAVR YALADCELGR CLVAESERGI CAILLGDDDA TLISELQQMF PAADNAPADL
MFQQHVREVI ASLNQRDTPL TLPLDIRGTA FQQQVWQALR TIPCGETVSY QQLANAIGKP
KAVRAVASAC AANKLAIIIP CHRVVRGDGT LSGYRWGVSR KAQLLRREAE NEER
Length

354

Mol. Wt

39.323 kDa

pI

8.8 (calculated)

Extinction coefficient

36,440 - 37,940 (calc based on 6 Y, 5 W, and 12 C residues)


Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type Residues Description Notes References

Domain

10..75

PF02805 Metal binding domain of Ada

PMID:19920124

Domain

95..133

PF00165 Bacterial regulatory helix-turn-helix proteins, AraC family

PMID:19920124

Domain

140..182

PF00165 Bacterial regulatory helix-turn-helix proteins, AraC family

PMID:19920124

Domain

269..353

PF01035 6-O-methylguanine DNA methyltransferase, DNA binding domain

PMID:19920124

Domain

188..266

PF02870 6-O-methylguanine DNA methyltransferase, ribonuclease-like domain

PMID:19920124

<motif_map/>

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=ada taxon=562,83333 </beststructure>

Models

View models at:

</protect>

Structure figures

<protect>

</protect>

Notes

Gene Product Resources

[back to top]


See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type Source Notes/Reference

<protect></protect>

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

NCBI (Protein) (EcoliWiki Page)

GI:16130150

Escherichia coli str. K-12 substr. MG1655

NCBI (Protein) (EcoliWiki Page)

GeneID:946710

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0007311

Escherichia coli str. K-12 substr. MG1655

UniProt (EcoliWiki Page)

UniProtKB/Swiss-Prot:P06134

Escherichia coli str. K-12 substr. MG1655

EcoCyc

EcoCyc:EG10029

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10029

Escherichia coli str. K-12 substr. MG1655

NCBI (Gene) (EcoliWiki Page)

GeneID:946710

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000026

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0028

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]




Expression

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.


Cellular Levels

[back to top]


See Help:Cellular levels

Molecule Organism or Strain Value Units Experimental Conditions Assay used Notes Reference(s)

Protein

E. coli K-12 MG1655

21

molecules/cell/generation

  • Medium: MOPS Complete
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Protein

E. coli K-12 MG1655

15

molecules/cell/generation

  • Medium: MOPS Minimal
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Protein

E. coli K-12 MG1655

8a

molecules/cell/generation

  • Medium: MOPS Complete without Methionine
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

Low confidence in the sequencing data set.

PMID: 24766808

Notes

Transcription and Transcriptional Regulation

[back to top]


<protect>

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)

ada-alkB

Figure courtesy of RegulonDB

</protect>

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]


<protect><gbrowseImage> name=NC_000913:2308407..2308447 source=MG1655 flip=1 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

</protect>

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]


<protect> Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name Mutation Phenotype Reference


Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type Reference Notes

microarray

GEO Profiles:b2213 (EcoliWiki Page)

NCBI GEO profiles for ada

microarray

GenExpDB:b2213 (EcoliWiki Page)

Summary of data for ada from multiple microarray studies


Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name Resource Type Description Source Notes

GFP Fusion

Intergenic region (2308332..2308580) fused to gfpmut2.

OpenBioSystems

GFP fusion described in Zaslaver, et al.
Plate:109-AZ12; Well:F1[7]

<protect></protect>

Notes

Accessions Related to ada Expression

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10029

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0028

Escherichia coli str. K-12 substr. MG1655

EcoliGenExpDB (EcoliWiki Page)

EcoliGenExpDB:b2213

EcoGene

EcoGene:EG10029

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000026

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0007311

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]



Evolution

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]


See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism Homologs (Statistics) Comments

Apis mellifera

  • ENSAPMP00000020221 (score: 1.000; bootstrap: 55%)

From Inparanoid:20070104

Caenorhabditis briggsae

  • WBGene00024971 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Caenorhabditis elegans

  • WBGene00000093 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Canis familiaris

  • ENSCAFP00000019538 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Dictyostelium discoideum

  • DDB0232973 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Drosophila melanogaster

  • FBgn0024912 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Drosophila pseudoobscura

  • GA11984-PA (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Homo sapiens

  • ENSP00000302111 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Macaca mulatta

  • ENSMMUP00000015013 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Mus musculus

  • MGI:96977 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Pan troglodytes

  • ENSPTRP00000005382 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Rattus norvegicus

  • ENSRNOP00000021537 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Takifugu rubripes

  • NEWSINFRUP00000131192 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Tetraodon nigroviridis

  • GSTENP00024953001 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Shigella flexneri

ADA

From SHIGELLACYC

E. coli O157

ADA

From ECOO157CYC


Do-It-Yourself Web Tools

<protect></protect>

Notes

Families

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

Pfam (EcoliWiki Page)

PF00165 Bacterial regulatory helix-turn-helix proteins, AraC family

Pfam (EcoliWiki Page)

PF02805 Metal binding domain of Ada

Pfam (EcoliWiki Page)

PF00165 Bacterial regulatory helix-turn-helix proteins, AraC family

Pfam (EcoliWiki Page)

PF02870 6-O-methylguanine DNA methyltransferase, ribonuclease-like domain

Pfam (EcoliWiki Page)

PF01035 6-O-methylguanine DNA methyltransferase, DNA binding domain

Superfamily (EcoliWiki Page)

SUPERFAMILY:46689

Superfamily (EcoliWiki Page)

SUPERFAMILY:46767

Superfamily (EcoliWiki Page)

SUPERFAMILY:53155

Superfamily (EcoliWiki Page)

SUPERFAMILY:57884

EcoCyc

EcoCyc:EG10029

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10029

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000026

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0028

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0007311

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]



References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. 2.0 2.1 2.2 2.3 2.4 2.5 2.6 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  3. 3.0 3.1 3.2 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  4. 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
  5. 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
  6. 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
  7. Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed

Categories

[back to top]