acpP:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
| Standard Name |
acpP |
|---|---|
| Gene Synonym(s) |
ECK1080, b1094, JW1080[1], JW1080 |
| Product Desc. | |
| Product Synonyms(s) |
acyl carrier protein (ACP)[1], B1094[2][1] , ECK1080, JW1080, b1094 |
| Function from GO |
<GO_nr /> |
| Knock-Out Phenotype | |
| Regulation/Expression |
transcription unit(s): fabG-acpP[2], fabDG-acpP[2], acpP-fabF[2] |
| Regulation/Activity | |
| Quick Links |
|
| edit table |
See Help:Quickview for help with entering information in the Quickview table.
Notes
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
acpP |
|---|---|
| Mnemonic |
Acyl carrier protein |
| Synonyms |
ECK1080, b1094, JW1080[1], JW1080 |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
NC_012759: 1054763..1054999 |
||||
|
MG1655 |
24.8 minutes |
MG1655: 1150838..1151074 |
||
|
NC_012967: 1166184..1166420 |
||||
|
W3110 |
|
W3110: 1153192..1153428 |
||
|
DH10B: 1206283..1206519 |
||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
1150841 |
Edman degradation |
PMID:2062368 |
| |
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
acpPS37A,T |
S37A,T |
Loss of phosphopantetheinylation, and inhibition of cell growth |
seeded from UniProt:P0A6A8 | ||||
| edit table |
Notes
Genetic Interactions
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW1080 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCAGCACTATCGAAGAACGCGT Primer 2:CCgGCCTGGTGGCCGTTGATGTA | |
|
Kohara Phage |
PMID:3038334 | ||
|
Kohara Phage |
PMID:3038334 | ||
|
Linked marker |
est. P1 cotransduction: % [5] | ||
|
Linked marker |
est. P1 cotransduction: 86% [5] | ||
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG50003 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG50003 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120002562 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EchoBASE:EB4297 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0003703 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
| Standard name |
AcpP |
|---|---|
| Synonyms |
acyl carrier protein (ACP)[1], B1094[2][1] , ECK1080, JW1080, b1094 |
| Product description | |
| EC number (for enzymes) |
|
| edit table |
Notes
Function
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
| Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
|---|---|---|---|---|---|---|---|---|
| GO:0000036 |
acyl carrier activity |
IDA: Inferred from Direct Assay |
F |
complete | ||||
| GO:0006633 |
fatty acid biosynthetic process |
IMP: Inferred from Mutant Phenotype |
P |
complete | ||||
| GO:0008610 |
lipid biosynthetic process |
IMP: Inferred from Mutant Phenotype |
P |
complete | ||||
| GO:0031177 |
phosphopantetheine binding |
IMP: Inferred from Mutant Phenotype |
F |
complete | ||||
| GO:0005737 |
cytoplasm |
IDA: Inferred from Direct Assay |
C |
complete | ||||
| GO:0042493 |
response to drug |
IMP: Inferred from Mutant Phenotype |
P |
Seeded from EcoCyc (v14.0) |
complete | |||
| GO:0042493 |
response to drug |
IMP: Inferred from Mutant Phenotype |
P |
N-pentylpantothenamide and N-heptylpantothenamide |
complete | |||
| GO:0000035 |
acyl binding |
IDA: Inferred from Direct Assay |
F |
complete | ||||
| GO:0009245 |
lipid A biosynthetic process |
IMP: Inferred from Mutant Phenotype |
P |
complete | ||||
| edit table |
Interactions
See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
| Partner Type | Partner | Notes | References | Evidence |
|---|---|---|---|---|
|
Protein |
mukB |
Experiment(s):EBI-878935, EBI-894594 | ||
|
Protein |
plsB |
Experiment(s):EBI-878935 | ||
|
Protein |
ribF |
Experiment(s):EBI-878935 | ||
|
Protein |
rpsG |
Experiment(s):EBI-878935, EBI-882138 | ||
|
Protein |
secA |
Experiment(s):EBI-878935 | ||
|
Protein |
spoT |
Experiment(s):EBI-878935, EBI-886668 | ||
|
Protein |
ybgC |
Experiment(s):EBI-878935, EBI-882138 | ||
|
Protein |
ybgJ |
Experiment(s):EBI-878935 | ||
|
Protein |
yiiD |
Experiment(s):EBI-878935, EBI-882138, EBI-887888 | ||
|
Protein |
aas |
Experiment(s):EBI-878935 | ||
|
Protein |
aceE |
Experiment(s):EBI-878935 | ||
|
Protein |
aceF |
Experiment(s):EBI-878935 | ||
|
Protein |
acpS |
Experiment(s):EBI-878935, EBI-882138 | ||
|
Protein |
aidB |
Experiment(s):EBI-878935, EBI-882138 | ||
|
Protein |
yccX |
Experiment(s):EBI-878935 | ||
|
Protein |
insO2 |
Experiment(s):EBI-878935 | ||
|
Protein |
fabB |
Experiment(s):EBI-878935 | ||
|
Protein |
fabF |
Experiment(s):EBI-878935, EBI-882138, EBI-893240 | ||
|
Protein |
fabG |
Experiment(s):EBI-878935, EBI-882138 | ||
|
Protein |
fabH |
Experiment(s):EBI-878935 | ||
|
Protein |
fabZ |
Experiment(s):EBI-878935 | ||
|
Protein |
glmU |
Experiment(s):EBI-878935, EBI-882138 | ||
|
Protein |
lpdA |
Experiment(s):EBI-878935, EBI-882138 | ||
|
Protein |
lpxD |
Experiment(s):EBI-878935, EBI-882138 | ||
|
Protein |
malT |
Experiment(s):EBI-878935 | ||
|
Protein |
accA |
Experiment(s):EBI-882138 | ||
|
Protein |
hupB |
Experiment(s):EBI-882138 | ||
|
Protein |
rplO |
Experiment(s):EBI-882138 | ||
|
Protein |
rplV |
Experiment(s):EBI-882138 | ||
|
Protein |
rpmB |
Experiment(s):EBI-882138 | ||
|
Protein |
rpsF |
Experiment(s):EBI-882138 | ||
|
Protein |
rpsH |
Experiment(s):EBI-882138 | ||
|
Protein |
rpsM |
Experiment(s):EBI-882138 | ||
|
Protein |
yhbY |
Experiment(s):EBI-882138 | ||
|
Protein |
rpsM |
LCMS(ID Probability):99.6 | ||
|
Protein |
accA |
LCMS(ID Probability):99.6 | ||
|
Protein |
hupB |
LCMS(ID Probability):99.6 | ||
|
Protein |
rpsF |
LCMS(ID Probability):99.6 | ||
|
Protein |
yhbY |
LCMS(ID Probability):99.6 | ||
|
Protein |
lpxD |
LCMS(ID Probability):99.6 MALDI(Z-score):37.890659 | ||
|
Protein |
rplO |
LCMS(ID Probability):99.6 | ||
|
Protein |
rpsH |
LCMS(ID Probability):99.6 | ||
|
Protein |
plsB |
MALDI(Z-score):28.115910 | ||
|
Protein |
aidB |
LCMS(ID Probability):99.6 MALDI(Z-score):28.483346 | ||
|
Protein |
yiiD |
LCMS(ID Probability):99.6 MALDI(Z-score):39.085879 | ||
|
Protein |
ybgC |
LCMS(ID Probability):99.6 MALDI(Z-score):25.238576 | ||
|
Protein |
fabB |
MALDI(Z-score):47.576368 | ||
|
Protein |
fabF |
LCMS(ID Probability):99.6 MALDI(Z-score):38.711597 | ||
|
Protein |
fabG |
LCMS(ID Probability):99.6 MALDI(Z-score):17.053160 | ||
|
Protein |
ribF |
MALDI(Z-score):36.845456 | ||
|
Protein |
acpS |
LCMS(ID Probability):99.6 MALDI(Z-score):21.026827 | ||
|
Protein |
aas |
MALDI(Z-score):28.197629 | ||
|
Protein |
glmU |
LCMS(ID Probability):99.6 MALDI(Z-score):39.768280 | ||
|
Protein |
rplL |
LCMS(ID Probability):99.6 | ||
| edit table |
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
| Compartment | Description | Evidence | Reference/Source | Notes |
|---|---|---|---|---|
| edit table |
Notes
Structure and Physical Properties
Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
| Name | |
|---|---|
| Sequence |
MSTIEERVKK IIGEQLGVKQ EEVTNNASFV EDLGADSLDT VELVMALEEE FDTEIPDEEA EKITTVQAAI DYINGHQA |
| Length |
78 |
| Mol. Wt |
8.638 kDa |
| pI |
3.8 (calculated) |
| Extinction coefficient |
1,490 (calc based on 1 Y, 0 W, and 0 C residues) |
| edit table |
Domains/Motifs/Modification Sites
|
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
|
Structure
|
Structure figures
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
| Resource type | Source | Notes/Reference |
|---|---|---|
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
ASAP:ABE-0003703 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EcoCyc:EG50003 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG50003 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
RegulonDB:ECK120002562 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB4297 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
| Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
|---|---|---|---|---|---|---|---|
|
Protein |
E. coli K-12 MC4100 |
1.02E+04 |
molecules/cell |
|
emPAI |
PMID:18304323 | |
|
Protein |
E. coli K-12 MG1655 |
357865 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
85961 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
214887 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
| edit table |
Notes
Transcription and Transcriptional Regulation
|
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
 |
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<gbrowseImage> name=NC_000913:1150818..1150858 source=MG1655 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
| Allele Name | Mutation | Phenotype | Reference |
|---|---|---|---|
| edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
| Type | Reference | Notes |
|---|---|---|
|
microarray |
NCBI GEO profiles for acpP | |
|
microarray |
Summary of data for acpP from multiple microarray studies | |
| edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
| Resource Name | Resource Type | Description | Source | Notes |
|---|---|---|---|---|
|
GFP Fusion |
Intergenic region (1150546..1150884) fused to gfpmut2. |
GFP fusion described in Zaslaver, et al. | ||
| edit table |
<protect>
Notes
Accessions Related to acpP Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG50003 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB4297 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG50003 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120002562 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0003703 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
| Organism | Homologs (Statistics) | Comments |
|---|---|---|
|
Anopheles gambiae |
|
From Inparanoid:20070104 |
|
Apis mellifera |
|
From Inparanoid:20070104 |
|
Arabidopsis thaliana |
|
From Inparanoid:20070104 |
|
Bos taurus |
|
From Inparanoid:20070104 |
|
Caenorhabditis briggsae |
|
From Inparanoid:20070104 |
|
Caenorhabditis elegans |
|
From Inparanoid:20070104 |
|
Canis familiaris |
|
From Inparanoid:20070104 |
|
Danio rerio |
|
From Inparanoid:20070104 |
|
Dictyostelium discoideum |
|
From Inparanoid:20070104 |
|
Drosophila melanogaster |
|
From Inparanoid:20070104 |
|
Drosophila pseudoobscura |
|
From Inparanoid:20070104 |
|
Gallus gallus |
|
From Inparanoid:20070104 |
|
Homo sapiens |
|
From Inparanoid:20070104 |
|
Macaca mulatta |
|
From Inparanoid:20070104 |
|
Monodelphis domestica |
|
From Inparanoid:20070104 |
|
Mus musculus |
|
From Inparanoid:20070104 |
|
Oryza gramene |
|
From Inparanoid:20070104 |
|
Rattus norvegicus |
|
From Inparanoid:20070104 |
|
Saccharomyces cerevisiae |
|
From Inparanoid:20070104 |
|
Schizosaccharomyces pombe |
|
From Inparanoid:20070104 |
|
Takifugu rubripes |
|
From Inparanoid:20070104 |
|
Tetraodon nigroviridis |
|
From Inparanoid:20070104 |
|
Shigella flexneri |
ACPP |
From SHIGELLACYC |
|
E. coli O157 |
ACPP |
From ECOO157CYC |
| edit table |
Do-It-Yourself Web Tools
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG50003 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG50003 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120002562 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB4297 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0003703 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.0 1.1 1.2 1.3 1.4 1.5 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 2.2 2.3 2.4 2.5 2.6 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 CGSC: The Coli Genetics Stock Center
- ↑ 5.0 5.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ 6.0 6.1 6.2 6.3 6.4 Zhang, YM et al. (2004) Acyl carrier protein is a cellular target for the antibacterial action of the pantothenamide class of pantothenate antimetabolites. J. Biol. Chem. 279 50969-75 PubMed
- ↑ 7.0 7.1 7.2 7.3 De Lay, NR & Cronan, JE (2006) Gene-specific random mutagenesis of Escherichia coli in vivo: isolation of temperature-sensitive mutations in the acyl carrier protein of fatty acid synthesis. J. Bacteriol. 188 287-96 PubMed
- ↑ 8.00 8.01 8.02 8.03 8.04 8.05 8.06 8.07 8.08 8.09 8.10 8.11 8.12 8.13 8.14 8.15 8.16 8.17 8.18 8.19 8.20 8.21 8.22 8.23 8.24 8.25 8.26 8.27 8.28 8.29 8.30 8.31 8.32 8.33 Butland, G et al. (2005) Interaction network containing conserved and essential protein complexes in Escherichia coli. Nature 433 531-7 PubMed
- ↑ 9.00 9.01 9.02 9.03 9.04 9.05 9.06 9.07 9.08 9.09 9.10 9.11 9.12 9.13 9.14 9.15 9.16 9.17 9.18 9.19 Hu, P et al. (2009) Global functional atlas of Escherichia coli encompassing previously uncharacterized proteins. PLoS Biol. 7 e96 PubMed
- ↑ Finn, RD et al. (2010) The Pfam protein families database. Nucleic Acids Res. 38 D211-22 PubMed
- ↑ Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed
Categories
- GO:0000036 ! acyl carrier activity
- GO:0006633 ! fatty acid biosynthetic process
- GO:0008610 ! lipid biosynthetic process
- GO:0031177 ! phosphopantetheine binding
- GO:0005737 ! cytoplasm
- GO:0042493 ! response to drug
- GO:0000035 ! acyl binding
- GO:0009245 ! lipid A biosynthetic process
- Genes in OpenBioSystems with Promoter Fusions
- Genes with homologs in Anopheles gambiae
- Genes with homologs in Apis mellifera
- Genes with homologs in Arabidopsis thaliana
- Genes with homologs in Bos taurus
- Genes with homologs in Caenorhabditis briggsae
- Genes with homologs in Caenorhabditis elegans
- Genes with homologs in Canis familiaris
- Genes with homologs in Danio rerio
- Genes with homologs in Dictyostelium discoideum
- Genes with homologs in Drosophila melanogaster
- Genes with homologs in Drosophila pseudoobscura
- Genes with homologs in Gallus gallus
- Genes with homologs in Homo sapiens
- Genes with homologs in Macaca mulatta
- Genes with homologs in Monodelphis domestica
- Genes with homologs in Mus musculus
- Genes with homologs in Oryza gramene
- Genes with homologs in Rattus norvegicus
- Genes with homologs in Saccharomyces cerevisiae
- Genes with homologs in Schizosaccharomyces pombe
- Genes with homologs in Takifugu rubripes
- Genes with homologs in Tetraodon nigroviridis
- Genes with homologs in Shigella flexneri
- Genes with homologs in E. coli O157