trxA:Gene: Difference between revisions
Fixing zoom on GBrowse image. |
BatchPageAppend.php edit. |
||
| Line 391: | Line 391: | ||
[[Category:Genes in the Keio knockout collection]] | [[Category:Genes in the Keio knockout collection]] | ||
[[Category:Genes in the ASKA clone collection]] | [[Category:Genes in the ASKA clone collection]] | ||
[[Category:trx genes]][[Category:Gene_List:DH10B]] | [[Category:trx genes]][[Category:Gene_List:DH10B]][[Category:Gene_List:REL606]] | ||
Revision as of 00:09, 13 December 2009
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
trxA |
|---|---|
| Mnemonic | |
| Synonyms |
ECK3773, b3781, JW5856, fipA, tsnC, dasC[1] |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
85.43 minutes, 85.43 minutes |
MG1655: 3963784..3964113 |
||
|
W3110 |
|
W3110: 3670920..3670591 |
||
|
DH10B: 4062704..4063033 |
||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature type | Location | Description |
|---|---|---|
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔtrxA (Keio:JW5856) |
deletion |
deletion |
|||||
|
trxA1(Am) |
amber (UAG) mutation | ||||||
|
ΔtrxA307 |
|||||||
|
trxA11(ts) |
temperature sensitive |
| |||||
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW5856 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAGCGATAAAATTATTCACCT Primer 2:CCtGCCAGGTTAGCGTCGAGGAA | |
|
Linked marker |
est. P1 cotransduction: 69% [7] | ||
|
metEo-3079::Tn10 |
Linked marker |
est. P1 cotransduction: 14% [7] | |
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ Mark, DF et al. (1977) Genetic mapping of trxA, a gene affecting thioredoxin in Escherichia coli K12. Mol. Gen. Genet. 155 145-52 PubMed
- ↑ 4.0 4.1 Russel, M & Model, P (1985) Thioredoxin is required for filamentous phage assembly. Proc. Natl. Acad. Sci. U.S.A. 82 29-33 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 6.0 6.1 CGSC: The Coli Genetics Stock Center
- ↑ 7.0 7.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).