parC:Gene: Difference between revisions

From EcoliWiki
Jump to navigation Jump to search
← Older editNewer edit →
Edited by wikibot
imported>Wikientrybot
Move help links into the <above> tag inside templates.
Line 27: Line 27:
<!--
<!--
******************************************************************************************
******************************************************************************************
*
*  
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **  
*
*  
****************************************************************************************** -->
****************************************************************************************** -->{{Gene_nomenclature_help}}
{|{{Prettytable}}
{|border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;" {{Prettytable}}
 
|-
|-
!{{table_heading_style}} |Standard name
!align=left {{table_heading_style}} |Standard name
|
||
''parC''  
''parC''  
|-
|-
!{{table_heading_style}} |Mnemonic
!align=left {{table_heading_style}} |Mnemonic
|
||
partitioning of the nucleoid
partitioning of the nucleoid
|-
|-
!{{table_heading_style}} |Synonyms
!align=left {{table_heading_style}} |Synonyms
|
||
''ECK3010, b3019, JW2987''<ref name='LIB:Riley_2006'/>
''ECK3010, b3019, JW2987''<ref name='LIB:Riley_2006'/>
|-
 
|colspan='3'|[{{SERVER}}{{SCRIPTPATH}}/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.16595.C46a9eba98290f&page=16595&pagename={{FULLPAGENAMEE}} edit table]
|-class='sortbottom'
|[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.16595.C46a9eba98290f&page=16595&pagename={{FULLPAGENAMEE}}&type=1&template=Gene_nomenclature_table edit table] ||
|}
|}
<!--box uid=421aa90e079fa326b6494f812ad13e79.16595.C46a9eba98290f-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.16595.C46a9eba98290f-->
{{Gene_nomenclature_help}}
 
<!--Nomenclature_notes--></protect>
<!--Nomenclature_notes--></protect>
===Notes===
===Notes===
Line 59: Line 61:
<!--
<!--
******************************************************************************************
******************************************************************************************
*
*  
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **  
*
*  
****************************************************************************************** -->
****************************************************************************************** -->{{Gene_location_help}}
{|class = 'sortable' {{Prettytable}} id='142982'
{|class = 'sortable' border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;" 
|- {{table_heading_style}}
|- {{table_heading_style}}
!Strain!!Map location!!Genome coordinates!!Genome browsers!!Sequence links
!|Strain!!Map location!!Genome coordinates!!Genome browsers!!Sequence links
|-
|-  
|
|
MG1655
MG1655
Line 80: Line 82:
{{GBrowseFastaLink|ecoli|NC_000913|3161737|3163995|FASTA Dump}}
{{GBrowseFastaLink|ecoli|NC_000913|3161737|3163995|FASTA Dump}}
*[http://biocyc.org/ECOLI/sequence?object=EG10686 EcoCyc Sequence Dump]  
*[http://biocyc.org/ECOLI/sequence?object=EG10686 EcoCyc Sequence Dump]  
|-
|-  
|
|
W3110
W3110
Line 91: Line 93:
|
|
{{GBrowseFastaLink|ecoli_W3110|AC_000091|3162371|3164629|FASTA Dump}}  
{{GBrowseFastaLink|ecoli_W3110|AC_000091|3162371|3164629|FASTA Dump}}  
|-class='sortbottom'
|-class='sortbottom'
|[{{SERVER}}{{SCRIPTPATH}}/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.16595.T46a9ebaa0dd6c&page=16595&pagename={{FULLPAGENAMEE}} edit table] || || || ||
|[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.16595.T46a9ebaa0dd6c&page=16595&pagename={{FULLPAGENAMEE}}&type=0&template=Gene_location_table edit table] || || || ||
|}
|}
<!--box uid=421aa90e079fa326b6494f812ad13e79.16595.T46a9ebaa0dd6c-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.16595.T46a9ebaa0dd6c-->
{{Gene_location_help}}
 
<!--Location_notes--></protect>
<!--Location_notes--></protect>
===Notes===
===Notes===
Line 105: Line 108:
<!--
<!--
******************************************************************************************
******************************************************************************************
*
*  
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **  
*
*  
****************************************************************************************** -->
****************************************************************************************** -->{{Gene_sequence_features_help}}
{|class = 'sortable' {{Prettytable}} id='142983'
{|class = 'sortable' border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;" 
|- {{table_heading_style}}
|- {{table_heading_style}}
!Feature type!!Location!!Description
!|Feature type!!Location!!Description
 
|-class='sortbottom'
|-class='sortbottom'
|[{{SERVER}}{{SCRIPTPATH}}/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.16595.L46a9ebaabfe85&page=16595&pagename={{FULLPAGENAMEE}} edit table] || ||
|[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.16595.L46a9ebaabfe85&page=16595&pagename={{FULLPAGENAMEE}}&type=0&template=Gene_sequence_features_table edit table] || ||
|}
|}
<!--box uid=421aa90e079fa326b6494f812ad13e79.16595.L46a9ebaabfe85-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.16595.L46a9ebaabfe85-->
{{Gene_sequence_features_help}}
 
<protect><!--Sequence_notes--></protect>
<protect><!--Sequence_notes--></protect>
====Notes====
====Notes====
Line 129: Line 133:
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **  
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **  
*  
*  
****************************************************************************************** -->
****************************************************************************************** -->{{Gene_alleles_help}}
{|class = 'sortable' border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;" {{Prettytable}}  
{|class = 'sortable' border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;" {{Prettytable}}  
|- {{table_heading_style}}
|- {{table_heading_style}}
Line 144: Line 148:
|
|
ts @ 42
ts @ 42
|
|[[PMID:2170028]]<ref name=PMID:2170028/>,[[PMID:2842295]]<ref name=PMID:2842295/>
[[PMID:2170028]]<ref name=PMID:2170028/>, [[PMID:2842295]]<ref name=PMID:2842295/>
|
|


Line 155: Line 158:
|}
|}
<!--box uid=421aa90e079fa326b6494f812ad13e79.16595.K46a9ebab13e41-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.16595.K46a9ebab13e41-->
{{Gene_alleles_help}}
 
<protect><!--Alleles_notes--></protect>
<protect><!--Alleles_notes--></protect>
===Notes===
===Notes===
Line 165: Line 168:
<!--
<!--
******************************************************************************************
******************************************************************************************
*
*  
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **  
*
*  
****************************************************************************************** -->
****************************************************************************************** -->{{Gene_resources_help}}
{|class = 'sortable' {{Prettytable}} id='142985'
{|class = 'sortable' border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;" 
|- {{table_heading_style}}
|- {{table_heading_style}}
!Resource!!Resource Type!!Source!!Notes/Reference
!|Resource!!Resource Type!!Source!!Notes/Reference
|-
|-  
|
|
JW2987
JW2987
Line 179: Line 182:
|
|
[http://www.shigen.nig.ac.jp/ecoli/strain/askaCloneQueryAction.do?strainTypeId=9 Shigen]
[http://www.shigen.nig.ac.jp/ecoli/strain/askaCloneQueryAction.do?strainTypeId=9 Shigen]
|
|[[PMID:16769691]]<ref name=PMID:16769691/>
[[PMID:16769691]]<ref name=PMID:16769691/>


Status:Clone OK
Status:Clone OK
Line 187: Line 189:


Primer 2:CCtTCTTCGCTATCACCGCTGCT  
Primer 2:CCtTCTTCGCTATCACCGCTGCT  
|-
|-  
|
|
[[metC:Gene|metC162::Tn10]]
[[metC:Gene|metC162::Tn10]]
Line 196: Line 198:
|
|
est. P1 cotransduction: 67% <ref name='LIB:Nichols_linked_Tn'/>  
est. P1 cotransduction: 67% <ref name='LIB:Nichols_linked_Tn'/>  
|-
|-  
|
|
[[tolC:Gene|tolC210::Tn10]]
[[tolC:Gene|tolC210::Tn10]]
Line 205: Line 207:
|
|
est. P1 cotransduction: 56% <ref name='LIB:Nichols_linked_Tn'/>  
est. P1 cotransduction: 56% <ref name='LIB:Nichols_linked_Tn'/>  
|-class='sortbottom'
|-class='sortbottom'
|[{{SERVER}}{{SCRIPTPATH}}/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.16595.T46a9ebabc5e3a&page=16595&pagename={{FULLPAGENAMEE}} edit table] || || ||
|[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.16595.T46a9ebabc5e3a&page=16595&pagename={{FULLPAGENAMEE}}&type=&template=Gene_resource_table edit table] || || ||
|}
|}
<!--box uid=421aa90e079fa326b6494f812ad13e79.16595.T46a9ebabc5e3a-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.16595.T46a9ebabc5e3a-->
{{Gene_resources_help}}
 
<protect><!--Gene_resources_notes--></protect>
<protect><!--Gene_resources_notes--></protect>
===Notes===
===Notes===
Line 222: Line 225:
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **  
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **  
*  
*  
****************************************************************************************** -->
****************************************************************************************** -->{{Gene_accessions_help}}
{|class = 'sortable' border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;"   
{|class = 'sortable' border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;"   
|- {{table_heading_style}}
|- {{table_heading_style}}
Line 279: Line 282:
[https://asap.ahabs.wisc.edu/asap/logon.php ASAP] ([[ASAP|EcoliWikiPage]])
[https://asap.ahabs.wisc.edu/asap/logon.php ASAP] ([[ASAP|EcoliWikiPage]])
|
|
[http://asap.ahabs.wisc.edu/asap/feature_info.php?LocationID=WIS&FeatureID=0009916&formSubmitReturn=1 ASAP:ABE-0009916]
[http://asap.ahabs.wisc.edu/asap/feature_info.php?LocationID=WIS&FeatureID=0009916&formSubmitReturn=1 ASAP:ABE-0009916]
|
|
   
   
Line 287: Line 290:
|}
|}
<!--box uid=421aa90e079fa326b6494f812ad13e79.16595.P46a9ebac6bc4d-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.16595.P46a9ebac6bc4d-->
{{Gene_accessions_help}}
 
<protect><!--Gene_accessions_notes--></protect>
<protect><!--Gene_accessions_notes--></protect>
===Notes===
===Notes===
Line 297: Line 300:
<!--
<!--
******************************************************************************************
******************************************************************************************
*
*  
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **
*  ** PLEASE DON'T EDIT THIS TABLE DIRECTLY.  Use the edit table link under the table. **  
*
*  
****************************************************************************************** -->
****************************************************************************************** -->
{|class = 'sortable' {{Prettytable}} id='142987'
{|class = 'sortable' border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;" 
|- {{table_heading_style}}
|- {{table_heading_style}}
!Name!!URL!!Comments
!|Name!!URL!!Comments
 
|-class='sortbottom'
|-class='sortbottom'
|[{{SERVER}}{{SCRIPTPATH}}/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.16595.M46a9ebb003b46&page=16595&pagename={{FULLPAGENAMEE}} edit table] || ||
|[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.16595.M46a9ebb003b46&page=16595&pagename={{FULLPAGENAMEE}}&type=0&template=Links_table edit table] || ||
|}
|}
<!--box uid=421aa90e079fa326b6494f812ad13e79.16595.M46a9ebb003b46-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.16595.M46a9ebb003b46-->
{{Links_help}}
 


<noinclude><protect>
<noinclude><protect>
==References==
==References==
{{BacktoTop}}
{{BacktoTop}}
{{RefHelp}}
 
<references/>
<references/>
__NOTOC__
__NOTOC__

Revision as of 22:20, 21 January 2009

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Alleles and Phenotypes Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

parC

Mnemonic

partitioning of the nucleoid

Synonyms

ECK3010, b3019, JW2987[1]

edit table


Notes

The partitioning defect comes from the inability of these cells to partition the nucleoids into daughter cells. This leads to filamented cells with a cluster of DNA and other DNA- free cells

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

68.15 minutes 

MG1655: 3163995..3161737
gbrowse_img.php?coord=3160737..3164995&genome=ecoli&name=MG1655&trackset=0&width=300&.png

W3110

 

W3110: 3164629..3162371
gbrowse_img.php?coord=3161371..3165629&genome=ecoli_W3110&name=W3110&trackset=0&width=300&.png

edit table


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature type Location Description
edit table


Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

parC1215

Growth Phenotype

ts @ 42

PMID:2170028[2],PMID:2842295[3]


edit table


Notes

The Keio collection[4] lists a deletion of parC, which is an essential gene. The insertion in this strain probably traps a duplication of the parC region.

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW2987

Plasmid clone

Shigen

PMID:16769691[5]

Status:Clone OK

Primer 1:GCCAGCGATATGGCAGAGCGCCT

Primer 2:CCtTCTTCGCTATCACCGCTGCT

metC162::Tn10

Linked marker

CAG18475 = CGSC7435[6]

est. P1 cotransduction: 67% [7]

tolC210::Tn10

Linked marker

CAG12184 = CGSC7437[6]

est. P1 cotransduction: 56% [7]

edit table


Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc (EcoliWiki Page)

EcoCyc:EG10686

EchoBASE (EcoliWiki Page)

EchoBASE:EB0680

EcoliGenExpDB (EcoliWiki Page)

EcoliGenExpDB:b3019

ECOL199310CYC (EcoliWiki Page)

ECOL199310CYC:C3760

EcoGene (EcoliWiki Page)

EcoGene:EG10686

ECOO157CYC (EcoliWiki Page)

ECOO157CYC:PARC

CGSC (EcoliWiki Page)

CGSC:33440

ASAP (EcoliWikiPage)

ASAP:ABE-0009916


edit table


Notes

Links

[back to top]


Name URL Comments
edit table


References

[back to top]


  1. ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. ↑ Kato, J et al. (1990) New topoisomerase essential for chromosome segregation in E. coli. Cell 63 393-404 PubMed
  3. ↑ Kato, J et al. (1988) Gene organization in the region containing a new gene involved in chromosome partition in Escherichia coli. J. Bacteriol. 170 3967-77 PubMed
  4. ↑ Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
  5. ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
  6. ↑ 6.0 6.1 CGSC: The Coli Genetics Stock Center
  7. ↑ 7.0 7.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).


Categories

Retrieved from "https://ecoliwiki.org/colipedia/index.php?title=parC:Gene&oldid=658006"