gyrB:Gene: Difference between revisions
Table edited by Joncrz via TableEdit |
Table edited by KSharma via TableEdit |
||
| Line 449: | Line 449: | ||
| | | | ||
Strain LE316, parental strain LE234 | Strain LE316, parental strain LE234 | ||
|- | |||
| | |||
Multicopy ''gyrB'' in strain RYC1010 | |||
| | |||
| | |||
| | |||
Resistant to | |||
| | |||
Increased resistance towards coumermycin A1 | |||
| | |||
PMID:1656457 | |||
| | |||
| | |||
The use of plasmid pCID549 was used to increase gene dosage of gyrB causing increased resistance toward coumermycin A1. | |||
|- class="tableEdit_footer" | |- class="tableEdit_footer" | ||
Revision as of 17:19, 25 October 2012
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
gyrB |
|---|---|
| Mnemonic |
Gyrase |
| Synonyms |
ECK3691, b3699, JW5625, Cou, himB, hisU, nalC, nalD, pcbA, parA, hopA, pcpA[1], acrB, pcpA |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
83.53 minutes, 83.53 minutes |
MG1655: 3878142..3875728 |
||
|
NC_012967: 3840480..3838066 |
||||
|
NC_012759: 3764061..3766475 |
||||
|
W3110 |
|
W3110: 3760296..3762710 |
||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
3875731 |
Edman degradation |
| ||
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
gyrBD426N |
D426N |
(in nal-24, nal-102, nal-103, nal- 107, nal-108, nal-111, nal-114, en-2 and en-5 mutants; resistant to nalidixic acid and to enoxacin) |
Strain variation; seeded from UniProt:P0AES6 | ||||
|
gyrBK447E |
K447E |
(in nal-31, nal-109, nal-115 and nal-120 mutants; resistant to nalidixic acid) |
Strain variation; seeded from UniProt:P0AES6 | ||||
|
gyrBW751R |
W751R |
(in B17 resistant mutant) |
Strain variation; seeded from UniProt:P0AES6 | ||||
|
gyrBSR759RC |
SR759RC |
(in acriflavine susceptible mutant) |
Strain variation; seeded from UniProt:P0AES6 | ||||
|
gyrB41(Const) |
|||||||
|
gyrB226 |
|||||||
|
gyrB225 |
|||||||
|
gyrB204 |
|||||||
|
gyrB203(ts) |
temperature sensitive |
||||||
|
gyrB221(CouR) |
coumermycin resistant |
||||||
|
gyrB234(ts) |
Cell Shape |
at permissive temperature (30°C), the average cell volume is larger than the gyrB+ parent (LE234) |
Strain LE316 | ||||
|
nalD in strain AB1157-81 |
Resistant to |
Mutant is resistant to Nalidixic acid (NAL) at 37C and sensitive at 30C |
Strain: AB1157-81 |
Figure 3 | |||
|
gyrB234(ts) |
Resistant to |
Resistant to chlorobiocin (50 ug/ml) (at permissive growth temperatures) |
Strain LE316, parental strain LE234 | ||||
|
gyrB234(ts) |
Growth Phenotype |
Temperature-sensitive growth, the plating efficiency at 42°C is less than 10-7 that of the gyrB{ parental strain LE234 |
Strain LE316, parental strain is LE234 | ||||
|
gyrB234(ts) |
Resistant to |
Coumermycin A1 resistant (at permissive growth temperatures) |
Strain LE316, parental strain LE234 | ||||
|
Multicopy gyrB in strain RYC1010 |
Resistant to |
Increased resistance towards coumermycin A1 |
The use of plasmid pCID549 was used to increase gene dosage of gyrB causing increased resistance toward coumermycin A1. | ||||
| edit table |
Notes
Genetic Interactions
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW5625 |
Plasmid clone |
Status:cloned as old JW Primer 1:GCCTCGAATTCTTATGACTCCTC Primer 2:CCAATATCGATATTCGCCGCTTT | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
zid-501::Tn10 |
Linked marker |
est. P1 cotransduction: 95% [9] | |
|
Linked marker |
est. P1 cotransduction: 7% [9] | ||
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Adachi, T et al. (1987) DNA sequence of the E. coli gyrB gene: application of a new sequencing strategy. Nucleic Acids Res. 15 771-84 PubMed
- ↑ 3.0 3.1 3.2 3.3 Orr, E et al. (1979) Isolation and characterisation of a strain carrying a conditional lethal mutation in the cou gene of Escherichia coli K12. Mol. Gen. Genet. 177 103-12 PubMed
- ↑ Hrebenda, J et al. (1985) Mutation affecting resistance of Escherichia coli K12 to nalidixic acid. J. Gen. Microbiol. 131 2285-92 PubMed
- ↑ del Castillo, I et al. (1991) An unusual mechanism for resistance to the antibiotic coumermycin A1. Proc. Natl. Acad. Sci. U.S.A. 88 8860-4 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 7.0 7.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 8.0 8.1 CGSC: The Coli Genetics Stock Center
- ↑ 9.0 9.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).