ftsK:Gene: Difference between revisions
imported>Wikientrybot Refreshing information from GenBank record NC_000913 |
Table edited by Whitley via TableEdit |
||
| Line 366: | Line 366: | ||
| | | | ||
abnormal nucleoid segregation- asymmetrically positioned nucleoids and large anucleate regions | abnormal nucleoid segregation- asymmetrically positioned nucleoids and large anucleate regions | ||
inhibited cell-cell separation | |||
| | | | ||
* PMID:9294448 | * PMID:9294448 | ||
Revision as of 19:24, 14 November 2011
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
ftsK |
|---|---|
| Mnemonic |
filamentation temperature sensitive Filamentation, temperature sensitive |
| Synonyms |
ECK0881, b0890, JW0873, dinH[1], dinH |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
20.1 minutes |
MG1655: 932447..936436 |
||
|
NC_012967: 950282..954310 |
||||
|
NC_012759: 835415..839404 |
||||
|
W3110 |
|
W3110: 933646..937635 |
||
|
DH10B: 986375..990364 |
||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔLC |
Carries a deletion of FtsK L and FtsK C | ||||||
|
ftsKG80A |
G80A |
In Toe44; loss of function under extreme conditions |
seeded from UniProt:P46889 | ||||
|
ftsKE58A |
E58A |
Loss of function |
seeded from UniProt:P46889 | ||||
|
NC |
Barre |
Deletion of the FtsK Linker | |||||
|
NL hi C |
Barre |
Carries swaps b/t E.coli and H. influenzae FtsK regions | |||||
|
ftsK A |
K997A |
Barre |
Carries a single point mutation in the walker A motif of FtsK C | ||||
|
NLC hi |
Barre |
Carries swaps b/t E.coli and H.influenzae FtsK regions | |||||
|
ftsk::cat1 |
Donachie Sheratt |
only expresses the NTD due to a Cm resistance cassette at nt 678 of ftsK | |||||
|
ftsk44 |
missense mutation |
G80A |
Growth Phenotype |
temperature sensitive late stage block in division, but does not affect chromosome replication or segregation |
Donachie |
this is the allele from the TOE44 strain listed in this table. | |
|
ftsK1::cat |
abnormal nucleoid segregation- asymmetrically positioned nucleoids and large anucleate regions inhibited cell-cell separation |
defect in the C-terminus of FtsK | |||||
|
ftsK1::cat ΔmukB |
Growth Phenotype |
synthetically lethal |
shown that it must be complemented in trans | ||||
|
ftsK::cat-2 |
Δ54-2201 |
almost the entire N-terminal membrane-spanning domain is deleted, and the C-terminal fragment is out of frame with the cat gene. Lethal- must be complemented in trans | |||||
|
ftsK::cat-Δ5 |
Δ54-3651 |
this is a deletion of 90% of ftsK | |||||
|
ftsK3531 |
missense mutation |
Growth Phenotype |
same phenotype as ftsK44- temperature sensitive late stage block in division, but does not affect chromosome replication or segregation |
suppressed by high salt (1% NaCl) in the medium or by insertional inactivation of the dacA gene, encoding PBP5. | |||
|
ftsK::cat-Δ2 ΔdacA::kan |
Cell Shape |
|
|||||
|
ftsK::cat-Δ5 Δdac::kan |
synthetically lethal |
||||||
|
ftsKC priA2::kan |
Growth Phenotype |
synthetically lethal |
|||||
|
ftsK1::cat ΔminB |
Growth Phenotype |
chains of minicells generated (many of which contained DNA) |
|||||
|
ftsK100 |
K997A |
ATP mutant |
| ||||
| edit table |
Notes
Deletions that leave the membrane segments intact are viable[9]. Suppressors of the ftsK chaining/filamentation phenotype are discussed in Geissler and Margolin (2005)[10].
Genetic Interactions
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0873 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAGCCAGGAATACATTGAAGA Primer 2:CCGTCAAACGGCGGTGGGGCCAG | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
zbh-29::Tn10 |
Linked marker |
est. P1 cotransduction: % [14] | |
|
zca-1230::Tn10 |
Linked marker |
est. P1 cotransduction: 61% [14] | |
|
W3110::Plac-ftsK |
Strain |
Depletion Strain[15] | |
|
pWL71 |
Plasmid Clone |
Pbad-FtsK(1-202)-GFP |
Successfully complements the W3110::Plac-ftsK depletion strain[15] |
|
pWL72 |
Plasmid Clone |
Pbad-FtsK(1-211)-GFP |
Successfully complements the W3110::Plac-ftsK depletion strain [15] |
|
pWL73 |
Plasmid Clone |
Pbad-FtsK(1-251)-GFP |
Successfully complements the W3110::Plac-ftsK depletion strain [15] |
|
pWL74 |
Plasmid Clone |
Pbad-FtsK(1-644) |
Successfully complements the W3110::Plac-ftsK depletion strain [15] |
|
pWL75 |
Plasmid Clone |
Pbad-FtsK(1-1329) |
Successfully complements the W3110::Plac-ftsK depletion strain [15] |
|
pWL76 |
Plasmid Clone |
Pbad-FtsK(1-19 and 637-1329)- N-terminal 19 amino acids fused in phase to amino acid residue 637 of FtsK |
Cannot complement the W3110::Plac-ftsK depletion strain [15] |
|
pFtsK-PhoA plasmids |
Plasmid Clone |
This represents multiple plasmids with phoA inserted at various positions[16]. | |
|
pFtsK-LacZ plasmids |
Plasmid Clone |
This represents multiple plasmids with lacZ inserted at various positions[16]. | |
|
pFLAG-FtsK plasmids |
Plasmid Clone |
This reference describes plasmids with various FtsK truncations N-terminally tagged to FLAG[17]. | |
|
MA3 |
Strain |
AB1157ftsK |
|
|
GR51 |
Strain |
AB1157xerCftsK |
|
|
GR59 |
Strain |
AB1157ftsK recA56 srl::Tn10 |
|
|
FC1 |
Strain |
AB1157, ftsK100 K997A (ATP mutant), CmR |
|
|
FtsK-YFP |
Plasmid Clone |
|
|
|
FtsKΔγ |
Plasmid Clone |
FtsK50C deleted from residue 1248 |
|
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 2.2 2.3 2.4 Bigot, S et al. (2004) FtsK activities in Xer recombination, DNA mobilization and cell division involve overlapping and separate domains of the protein. Mol. Microbiol. 54 876-86 PubMed
- ↑ 3.0 3.1 3.2 3.3 3.4 3.5 3.6 Draper, GC et al. (1998) Only the N-terminal domain of FtsK functions in cell division. J. Bacteriol. 180 4621-7 PubMed
- ↑ Begg, KJ et al. (1995) A new Escherichia coli cell division gene, ftsK. J. Bacteriol. 177 6211-22 PubMed
- ↑ Diez, AA et al. (1997) A mutation in the ftsK gene of Escherichia coli affects cell-cell separation, stationary-phase survival, stress adaptation, and expression of the gene encoding the stress protein UspA. J. Bacteriol. 179 5878-83 PubMed
- ↑ 6.0 6.1 6.2 Yu, XC et al. (1998) Role of the C terminus of FtsK in Escherichia coli chromosome segregation. J. Bacteriol. 180 6424-8 PubMed
- ↑ McCool, JD & Sandler, SJ (2001) Effects of mutations involving cell division, recombination, and chromosome dimer resolution on a priA2::kan mutant. Proc. Natl. Acad. Sci. U.S.A. 98 8203-10 PubMed
- ↑ 8.0 8.1 8.2 Kennedy, SP et al. (2008) Delayed activation of Xer recombination at dif by FtsK during septum assembly in Escherichia coli. Mol. Microbiol. 68 1018-28 PubMed
- ↑ Draper, GC et al. (1998) Only the N-terminal domain of FtsK functions in cell division. J. Bacteriol. 180 4621-7 PubMed
- ↑ Geissler, B & Margolin, W (2005) Evidence for functional overlap among multiple bacterial cell division proteins: compensating for the loss of FtsK. Mol. Microbiol. 58 596-612 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 12.0 12.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 13.0 13.1 CGSC: The Coli Genetics Stock Center
- ↑ 14.0 14.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ 15.0 15.1 15.2 15.3 15.4 15.5 15.6 Wang, L & Lutkenhaus, J (1998) FtsK is an essential cell division protein that is localized to the septum and induced as part of the SOS response. Mol. Microbiol. 29 731-40 PubMed
- ↑ 16.0 16.1 Dorazi, R & Dewar, SJ (2000) Membrane topology of the N-terminus of the Escherichia coli FtsK division protein. FEBS Lett. 478 13-8 PubMed
- ↑ Barre, FX et al. (2000) FtsK functions in the processing of a Holliday junction intermediate during bacterial chromosome segregation. Genes Dev. 14 2976-88 PubMed
- ↑ 18.0 18.1 18.2 Recchia, GD et al. (1999) FtsK-dependent and -independent pathways of Xer site-specific recombination. EMBO J. 18 5724-34 PubMed
- ↑ Graham, JE et al. (2010) FtsK translocation on DNA stops at XerCD-dif. Nucleic Acids Res. 38 72-81 PubMed